Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635740_at:

>probe:Drosophila_2:1635740_at:359:201; Interrogation_Position=1781; Antisense; AACCGAAGGTCAAGCGCACAGTGCC
>probe:Drosophila_2:1635740_at:507:607; Interrogation_Position=1824; Antisense; TGAGGAGGATATCCCCTCGGACACA
>probe:Drosophila_2:1635740_at:552:221; Interrogation_Position=1873; Antisense; AAGGTCATCAACAAGCAAGGCGTCA
>probe:Drosophila_2:1635740_at:245:709; Interrogation_Position=1908; Antisense; TTAAGATCGCAGACGCATCAGCTTC
>probe:Drosophila_2:1635740_at:192:275; Interrogation_Position=1929; Antisense; CTTCCTCCTGAGTTAATCGGGCATA
>probe:Drosophila_2:1635740_at:582:7; Interrogation_Position=1953; Antisense; ATTCCCGGACGCGAGATTAGTTTCT
>probe:Drosophila_2:1635740_at:484:459; Interrogation_Position=1967; Antisense; GATTAGTTTCTTCACGCAGTCAAAA
>probe:Drosophila_2:1635740_at:575:15; Interrogation_Position=2001; Antisense; ATTATTATCTTTTTCCCTCCAACAT
>probe:Drosophila_2:1635740_at:481:79; Interrogation_Position=2052; Antisense; AGGTTTCTTATTTATCATGCCCCAA
>probe:Drosophila_2:1635740_at:395:665; Interrogation_Position=2118; Antisense; TAAATTCAGACTAGCCGAGGGCCTT
>probe:Drosophila_2:1635740_at:553:83; Interrogation_Position=2135; Antisense; AGGGCCTTGCTCATATGATCCTCGA
>probe:Drosophila_2:1635740_at:23:283; Interrogation_Position=2155; Antisense; CTCGACGGGCAACGCTTTATATGTT
>probe:Drosophila_2:1635740_at:250:685; Interrogation_Position=2191; Antisense; TATAATTCTGTTTTGCTTAGGCACT
>probe:Drosophila_2:1635740_at:389:373; Interrogation_Position=2244; Antisense; GAAGTGCATTCCATGTAGCTAAGTT

Paste this into a BLAST search page for me
AACCGAAGGTCAAGCGCACAGTGCCTGAGGAGGATATCCCCTCGGACACAAAGGTCATCAACAAGCAAGGCGTCATTAAGATCGCAGACGCATCAGCTTCCTTCCTCCTGAGTTAATCGGGCATAATTCCCGGACGCGAGATTAGTTTCTGATTAGTTTCTTCACGCAGTCAAAAATTATTATCTTTTTCCCTCCAACATAGGTTTCTTATTTATCATGCCCCAATAAATTCAGACTAGCCGAGGGCCTTAGGGCCTTGCTCATATGATCCTCGACTCGACGGGCAACGCTTTATATGTTTATAATTCTGTTTTGCTTAGGCACTGAAGTGCATTCCATGTAGCTAAGTT

Full Affymetrix probeset data:

Annotations for 1635740_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime