FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635743_at:

>probe:Drosophila_2:1635743_at:164:27; Interrogation_Position=2930; Antisense; ATACGCACATTTTAAGCCGAAACCG
>probe:Drosophila_2:1635743_at:553:391; Interrogation_Position=2948; Antisense; GAAACCGAATGGTCCTAACTCTTCT
>probe:Drosophila_2:1635743_at:571:661; Interrogation_Position=2963; Antisense; TAACTCTTCTGCCACAAAGTTGAGA
>probe:Drosophila_2:1635743_at:288:185; Interrogation_Position=2996; Antisense; AACAACTATAACTCGAATGCAACTG
>probe:Drosophila_2:1635743_at:475:31; Interrogation_Position=3037; Antisense; ATAAGCGAAGACTGCCTGAATATGC
>probe:Drosophila_2:1635743_at:554:7; Interrogation_Position=3077; Antisense; ATTGCCAACAGCCACTAGCAGGTGT
>probe:Drosophila_2:1635743_at:515:489; Interrogation_Position=3104; Antisense; GTACTAGCCTGTGCATAGCAACCAC
>probe:Drosophila_2:1635743_at:20:673; Interrogation_Position=3168; Antisense; TAGTGATAAGGACCCGAATTCGTAT
>probe:Drosophila_2:1635743_at:398:481; Interrogation_Position=3189; Antisense; GTATTCGAACATGTGTACGTTCCAG
>probe:Drosophila_2:1635743_at:46:489; Interrogation_Position=3203; Antisense; GTACGTTCCAGTGAACCCAATCTAT
>probe:Drosophila_2:1635743_at:181:197; Interrogation_Position=3274; Antisense; AACGTTTGCTTGAGGTTTGATTTCA
>probe:Drosophila_2:1635743_at:721:643; Interrogation_Position=3308; Antisense; TCTAGCTAAATGTCTTCTGTCGAAG
>probe:Drosophila_2:1635743_at:230:283; Interrogation_Position=3324; Antisense; CTGTCGAAGCTCTTTTATATTGCAA
>probe:Drosophila_2:1635743_at:631:319; Interrogation_Position=3466; Antisense; GCGTAAATAAATCAAACCCACTTCT

Paste this into a BLAST search page for me
ATACGCACATTTTAAGCCGAAACCGGAAACCGAATGGTCCTAACTCTTCTTAACTCTTCTGCCACAAAGTTGAGAAACAACTATAACTCGAATGCAACTGATAAGCGAAGACTGCCTGAATATGCATTGCCAACAGCCACTAGCAGGTGTGTACTAGCCTGTGCATAGCAACCACTAGTGATAAGGACCCGAATTCGTATGTATTCGAACATGTGTACGTTCCAGGTACGTTCCAGTGAACCCAATCTATAACGTTTGCTTGAGGTTTGATTTCATCTAGCTAAATGTCTTCTGTCGAAGCTGTCGAAGCTCTTTTATATTGCAAGCGTAAATAAATCAAACCCACTTCT

Full Affymetrix probeset data:

Annotations for 1635743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720