FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635747_at:

>probe:Drosophila_2:1635747_at:375:537; Interrogation_Position=6978; Antisense; GGTCTTTCAGGAGTGGCTGCGCCAA
>probe:Drosophila_2:1635747_at:513:669; Interrogation_Position=7053; Antisense; TACCGTGGCCGTTATGTCCATGGTG
>probe:Drosophila_2:1635747_at:424:593; Interrogation_Position=7076; Antisense; TGGGATATATCCTCGGCCTGGGCGA
>probe:Drosophila_2:1635747_at:503:107; Interrogation_Position=7112; Antisense; AGAACATCCTGTTCGCCGAGGGCAA
>probe:Drosophila_2:1635747_at:176:141; Interrogation_Position=7151; Antisense; ACGTGGACTTCAATTGCCTGTTCAA
>probe:Drosophila_2:1635747_at:604:187; Interrogation_Position=7228; Antisense; AACATGATCGTTGCCATGGGTCCGC
>probe:Drosophila_2:1635747_at:48:501; Interrogation_Position=7258; Antisense; GTCGAGGGCAGCTTTCGCAAGTGCT
>probe:Drosophila_2:1635747_at:611:75; Interrogation_Position=7310; Antisense; AGGAGTCCAAGACCCTGATGTCCAT
>probe:Drosophila_2:1635747_at:484:11; Interrogation_Position=7333; Antisense; ATTCTGCGTCCCTTTGTCTACGATG
>probe:Drosophila_2:1635747_at:518:449; Interrogation_Position=7423; Antisense; GATCGCCTGCAAGGACACGTTAAAC
>probe:Drosophila_2:1635747_at:50:399; Interrogation_Position=7448; Antisense; GACAGCAGGCGAACAGCATTCCGCT
>probe:Drosophila_2:1635747_at:647:9; Interrogation_Position=7465; Antisense; ATTCCGCTTTCGACCGAAGGACAGG
>probe:Drosophila_2:1635747_at:169:73; Interrogation_Position=7482; Antisense; AGGACAGGTGAACTTCCTCATCAAT
>probe:Drosophila_2:1635747_at:685:201; Interrogation_Position=7525; Antisense; AACCTGGCGTCCATGTACATTGGCT

Paste this into a BLAST search page for me
GGTCTTTCAGGAGTGGCTGCGCCAATACCGTGGCCGTTATGTCCATGGTGTGGGATATATCCTCGGCCTGGGCGAAGAACATCCTGTTCGCCGAGGGCAAACGTGGACTTCAATTGCCTGTTCAAAACATGATCGTTGCCATGGGTCCGCGTCGAGGGCAGCTTTCGCAAGTGCTAGGAGTCCAAGACCCTGATGTCCATATTCTGCGTCCCTTTGTCTACGATGGATCGCCTGCAAGGACACGTTAAACGACAGCAGGCGAACAGCATTCCGCTATTCCGCTTTCGACCGAAGGACAGGAGGACAGGTGAACTTCCTCATCAATAACCTGGCGTCCATGTACATTGGCT

Full Affymetrix probeset data:

Annotations for 1635747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720