Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635748_at:

>probe:Drosophila_2:1635748_at:598:243; Interrogation_Position=1646; Antisense; AATTTGCCATATTGCCACGTTTTAG
>probe:Drosophila_2:1635748_at:113:665; Interrogation_Position=1668; Antisense; TAGCAATGGTAACCCCAAGGCCGTT
>probe:Drosophila_2:1635748_at:610:477; Interrogation_Position=1690; Antisense; GTTTACAGCCTAACCCACGAATCAG
>probe:Drosophila_2:1635748_at:699:531; Interrogation_Position=1752; Antisense; GGGTCCCATTCACGTGGTCAGATTG
>probe:Drosophila_2:1635748_at:722:139; Interrogation_Position=1763; Antisense; ACGTGGTCAGATTGTCGGCGGCAAA
>probe:Drosophila_2:1635748_at:726:51; Interrogation_Position=1834; Antisense; ATGCTGCAGCCGCTCTATGGCCATG
>probe:Drosophila_2:1635748_at:238:115; Interrogation_Position=1865; Antisense; AGCAGTATGTGTCGTCCTATGCGGC
>probe:Drosophila_2:1635748_at:359:325; Interrogation_Position=1892; Antisense; GCGACGAAGTGCAAGGTCCCAAGTT
>probe:Drosophila_2:1635748_at:301:125; Interrogation_Position=2004; Antisense; AGCCATAATACCATACTTCAGCCAT
>probe:Drosophila_2:1635748_at:463:681; Interrogation_Position=2044; Antisense; TATGGCACGCATTTGTACCATCCGG
>probe:Drosophila_2:1635748_at:138:631; Interrogation_Position=2064; Antisense; TCCGGGCGCAGCAACAGCATTGGGT
>probe:Drosophila_2:1635748_at:647:101; Interrogation_Position=2143; Antisense; AGAGCAGCGGGACCAAAGCAACAGT
>probe:Drosophila_2:1635748_at:356:255; Interrogation_Position=2156; Antisense; CAAAGCAACAGTCGACCGCAACAAG
>probe:Drosophila_2:1635748_at:182:527; Interrogation_Position=2184; Antisense; GGGACAGCTGCCAGGTGACAGTAAC

Paste this into a BLAST search page for me
AATTTGCCATATTGCCACGTTTTAGTAGCAATGGTAACCCCAAGGCCGTTGTTTACAGCCTAACCCACGAATCAGGGGTCCCATTCACGTGGTCAGATTGACGTGGTCAGATTGTCGGCGGCAAAATGCTGCAGCCGCTCTATGGCCATGAGCAGTATGTGTCGTCCTATGCGGCGCGACGAAGTGCAAGGTCCCAAGTTAGCCATAATACCATACTTCAGCCATTATGGCACGCATTTGTACCATCCGGTCCGGGCGCAGCAACAGCATTGGGTAGAGCAGCGGGACCAAAGCAACAGTCAAAGCAACAGTCGACCGCAACAAGGGGACAGCTGCCAGGTGACAGTAAC

Full Affymetrix probeset data:

Annotations for 1635748_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime