Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635751_at:

>probe:Drosophila_2:1635751_at:664:579; Interrogation_Position=121; Antisense; GGCCAGCAGGACTTTGGAGCACCTA
>probe:Drosophila_2:1635751_at:584:727; Interrogation_Position=134; Antisense; TTGGAGCACCTACGGCCAAGGATCA
>probe:Drosophila_2:1635751_at:188:545; Interrogation_Position=153; Antisense; GGATCAGGTGCTAAACCTCATTCGT
>probe:Drosophila_2:1635751_at:112:605; Interrogation_Position=161; Antisense; TGCTAAACCTCATTCGTTCCATACG
>probe:Drosophila_2:1635751_at:161:469; Interrogation_Position=176; Antisense; GTTCCATACGCACAGTGGCCAAAAT
>probe:Drosophila_2:1635751_at:457:83; Interrogation_Position=189; Antisense; AGTGGCCAAAATTCCCCTGATATTC
>probe:Drosophila_2:1635751_at:321:163; Interrogation_Position=197; Antisense; AAATTCCCCTGATATTCCTTAACAT
>probe:Drosophila_2:1635751_at:592:277; Interrogation_Position=20; Antisense; CTTTGTGGACACTGATTGAATCTTC
>probe:Drosophila_2:1635751_at:279:459; Interrogation_Position=207; Antisense; GATATTCCTTAACATAATTGCGATT
>probe:Drosophila_2:1635751_at:181:605; Interrogation_Position=32; Antisense; TGATTGAATCTTCACTCCTGTGCCT
>probe:Drosophila_2:1635751_at:372:651; Interrogation_Position=43; Antisense; TCACTCCTGTGCCTGAATGCGGTGT
>probe:Drosophila_2:1635751_at:640:233; Interrogation_Position=58; Antisense; AATGCGGTGTGCATTCTGCACGAGG
>probe:Drosophila_2:1635751_at:340:9; Interrogation_Position=70; Antisense; ATTCTGCACGAGGAACGCTTTCTGG
>probe:Drosophila_2:1635751_at:332:561; Interrogation_Position=81; Antisense; GGAACGCTTTCTGGCCAAGTTTGGC

Paste this into a BLAST search page for me
GGCCAGCAGGACTTTGGAGCACCTATTGGAGCACCTACGGCCAAGGATCAGGATCAGGTGCTAAACCTCATTCGTTGCTAAACCTCATTCGTTCCATACGGTTCCATACGCACAGTGGCCAAAATAGTGGCCAAAATTCCCCTGATATTCAAATTCCCCTGATATTCCTTAACATCTTTGTGGACACTGATTGAATCTTCGATATTCCTTAACATAATTGCGATTTGATTGAATCTTCACTCCTGTGCCTTCACTCCTGTGCCTGAATGCGGTGTAATGCGGTGTGCATTCTGCACGAGGATTCTGCACGAGGAACGCTTTCTGGGGAACGCTTTCTGGCCAAGTTTGGC

Full Affymetrix probeset data:

Annotations for 1635751_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime