FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635752_at:

>probe:Drosophila_2:1635752_at:47:97; Interrogation_Position=1046; Antisense; AGATCGATTTGCTTTCGGCATGCGT
>probe:Drosophila_2:1635752_at:705:567; Interrogation_Position=1062; Antisense; GGCATGCGTTTTGTTTTGGACCCAA
>probe:Drosophila_2:1635752_at:520:139; Interrogation_Position=606; Antisense; ACGTGGACCGCCAACTTTTACAATG
>probe:Drosophila_2:1635752_at:725:441; Interrogation_Position=665; Antisense; GATGAGATCGGTATCCGCACACTGG
>probe:Drosophila_2:1635752_at:529:433; Interrogation_Position=714; Antisense; GAGTGGAACGATCCCCAGAAACTGA
>probe:Drosophila_2:1635752_at:637:263; Interrogation_Position=757; Antisense; CAGCACGTTACTCCCATTATAACTA
>probe:Drosophila_2:1635752_at:574:15; Interrogation_Position=772; Antisense; ATTATAACTATTCCTTGGCTGCCAC
>probe:Drosophila_2:1635752_at:34:543; Interrogation_Position=810; Antisense; GGATTGGATGTCACCTACTGGCAGC
>probe:Drosophila_2:1635752_at:106:251; Interrogation_Position=860; Antisense; CAATCTCTTGGCGTGGAATCGTAAT
>probe:Drosophila_2:1635752_at:346:25; Interrogation_Position=883; Antisense; ATACCCGAAAGACCATTGCCACGAT
>probe:Drosophila_2:1635752_at:685:65; Interrogation_Position=917; Antisense; ATGGAACTTCTGGAACTCAGCCGTC
>probe:Drosophila_2:1635752_at:271:125; Interrogation_Position=935; Antisense; AGCCGTCCATGGGATGTTCGATTCG
>probe:Drosophila_2:1635752_at:584:305; Interrogation_Position=964; Antisense; CCTCCGTGGGCTTCATGTGGACAAA
>probe:Drosophila_2:1635752_at:636:163; Interrogation_Position=987; Antisense; AAATACCTGACGCATTTGCCACTGC

Paste this into a BLAST search page for me
AGATCGATTTGCTTTCGGCATGCGTGGCATGCGTTTTGTTTTGGACCCAAACGTGGACCGCCAACTTTTACAATGGATGAGATCGGTATCCGCACACTGGGAGTGGAACGATCCCCAGAAACTGACAGCACGTTACTCCCATTATAACTAATTATAACTATTCCTTGGCTGCCACGGATTGGATGTCACCTACTGGCAGCCAATCTCTTGGCGTGGAATCGTAATATACCCGAAAGACCATTGCCACGATATGGAACTTCTGGAACTCAGCCGTCAGCCGTCCATGGGATGTTCGATTCGCCTCCGTGGGCTTCATGTGGACAAAAAATACCTGACGCATTTGCCACTGC

Full Affymetrix probeset data:

Annotations for 1635752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720