FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635756_at:

>probe:Drosophila_2:1635756_at:394:645; Interrogation_Position=321; Antisense; TCAGGGTCAAGGACAATCCAATCTT
>probe:Drosophila_2:1635756_at:595:627; Interrogation_Position=337; Antisense; TCCAATCTTAGGTGGCAAACTAGCT
>probe:Drosophila_2:1635756_at:399:221; Interrogation_Position=368; Antisense; AAGTGAACATCCATCCTGGTGTGGC
>probe:Drosophila_2:1635756_at:529:209; Interrogation_Position=398; Antisense; AAGCACATCCAAATTTGTTCCCACA
>probe:Drosophila_2:1635756_at:318:243; Interrogation_Position=409; Antisense; AATTTGTTCCCACATCTTTACTGAC
>probe:Drosophila_2:1635756_at:723:151; Interrogation_Position=420; Antisense; ACATCTTTACTGACTTTTGTGCAAA
>probe:Drosophila_2:1635756_at:427:357; Interrogation_Position=440; Antisense; GCAAAGTTTTTGTACTACTCCGTAT
>probe:Drosophila_2:1635756_at:599:489; Interrogation_Position=451; Antisense; GTACTACTCCGTATTTGTATTTGTA
>probe:Drosophila_2:1635756_at:367:483; Interrogation_Position=478; Antisense; GTATACACCTGTTTTTCCGATCTAC
>probe:Drosophila_2:1635756_at:626:477; Interrogation_Position=488; Antisense; GTTTTTCCGATCTACATATTTCATG
>probe:Drosophila_2:1635756_at:667:385; Interrogation_Position=526; Antisense; GAACATCTTGGATTCAACACCATAC
>probe:Drosophila_2:1635756_at:164:665; Interrogation_Position=548; Antisense; TACAAACTTTTAGCTGGCGACCAAA
>probe:Drosophila_2:1635756_at:297:541; Interrogation_Position=700; Antisense; GGTTCACATTGTCATTCCAGTTTTA
>probe:Drosophila_2:1635756_at:482:651; Interrogation_Position=814; Antisense; TCAATTGACTTTGACTACTGGCAAT

Paste this into a BLAST search page for me
TCAGGGTCAAGGACAATCCAATCTTTCCAATCTTAGGTGGCAAACTAGCTAAGTGAACATCCATCCTGGTGTGGCAAGCACATCCAAATTTGTTCCCACAAATTTGTTCCCACATCTTTACTGACACATCTTTACTGACTTTTGTGCAAAGCAAAGTTTTTGTACTACTCCGTATGTACTACTCCGTATTTGTATTTGTAGTATACACCTGTTTTTCCGATCTACGTTTTTCCGATCTACATATTTCATGGAACATCTTGGATTCAACACCATACTACAAACTTTTAGCTGGCGACCAAAGGTTCACATTGTCATTCCAGTTTTATCAATTGACTTTGACTACTGGCAAT

Full Affymetrix probeset data:

Annotations for 1635756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720