Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635757_at:

>probe:Drosophila_2:1635757_at:229:121; Interrogation_Position=1826; Antisense; AGCGATCAATCGGTTGTGCAACTTC
>probe:Drosophila_2:1635757_at:52:615; Interrogation_Position=1842; Antisense; TGCAACTTCTATGCCGATCCGGGAA
>probe:Drosophila_2:1635757_at:554:1; Interrogation_Position=1867; Antisense; ATTGTTTCGGCCTTCAACGGCTTAT
>probe:Drosophila_2:1635757_at:238:197; Interrogation_Position=1882; Antisense; AACGGCTTATTGCTCGATGGCGATT
>probe:Drosophila_2:1635757_at:586:695; Interrogation_Position=1914; Antisense; TTTCGGCTATGGGTGAGTATCTCGC
>probe:Drosophila_2:1635757_at:539:483; Interrogation_Position=1944; Antisense; GTATCTGCCGCTGATATTGCAAGGC
>probe:Drosophila_2:1635757_at:657:359; Interrogation_Position=1962; Antisense; GCAAGGCCGGATCGAACCGCAGTAT
>probe:Drosophila_2:1635757_at:606:297; Interrogation_Position=2007; Antisense; CGCGCTAGCTACTTGTTTGTTTGTA
>probe:Drosophila_2:1635757_at:132:663; Interrogation_Position=2030; Antisense; TAAACAATACCGCAGTCACGTCGCA
>probe:Drosophila_2:1635757_at:332:35; Interrogation_Position=2111; Antisense; ATCAGCTGCGACAATCTCTGGACAG
>probe:Drosophila_2:1635757_at:339:323; Interrogation_Position=2150; Antisense; GCGCCTTGCGGCTGATAGTGCATAA
>probe:Drosophila_2:1635757_at:203:31; Interrogation_Position=2190; Antisense; ATAAATGCCGCGCTTATGGCTGCAC
>probe:Drosophila_2:1635757_at:145:69; Interrogation_Position=2205; Antisense; ATGGCTGCACAGACACGGAATACAC
>probe:Drosophila_2:1635757_at:531:279; Interrogation_Position=2335; Antisense; CTAAGTGTTTGCTCTACAGGCTGAA

Paste this into a BLAST search page for me
AGCGATCAATCGGTTGTGCAACTTCTGCAACTTCTATGCCGATCCGGGAAATTGTTTCGGCCTTCAACGGCTTATAACGGCTTATTGCTCGATGGCGATTTTTCGGCTATGGGTGAGTATCTCGCGTATCTGCCGCTGATATTGCAAGGCGCAAGGCCGGATCGAACCGCAGTATCGCGCTAGCTACTTGTTTGTTTGTATAAACAATACCGCAGTCACGTCGCAATCAGCTGCGACAATCTCTGGACAGGCGCCTTGCGGCTGATAGTGCATAAATAAATGCCGCGCTTATGGCTGCACATGGCTGCACAGACACGGAATACACCTAAGTGTTTGCTCTACAGGCTGAA

Full Affymetrix probeset data:

Annotations for 1635757_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime