FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635759_at:

>probe:Drosophila_2:1635759_at:721:559; Interrogation_Position=1269; Antisense; GGAAATGAAGTTCGCCCACATCACT
>probe:Drosophila_2:1635759_at:66:441; Interrogation_Position=1311; Antisense; GATGGCCACATATTTGGATCCGAGA
>probe:Drosophila_2:1635759_at:435:659; Interrogation_Position=1338; Antisense; TAAGCAAGCATTTTTCACCGAACGT
>probe:Drosophila_2:1635759_at:99:467; Interrogation_Position=1371; Antisense; GTTGGTGGCCAATGAAGTTCTGCTT
>probe:Drosophila_2:1635759_at:93:217; Interrogation_Position=1385; Antisense; AAGTTCTGCTTCAGCTCGCTGGAGT
>probe:Drosophila_2:1635759_at:49:79; Interrogation_Position=1415; Antisense; AGGATTGCAATGGTCAGCCACCGCT
>probe:Drosophila_2:1635759_at:693:599; Interrogation_Position=1454; Antisense; TGTCATCCACATCGTCCCAGAAGAA
>probe:Drosophila_2:1635759_at:142:383; Interrogation_Position=1523; Antisense; GAACGACGAACACTCAACAGCCAAA
>probe:Drosophila_2:1635759_at:648:63; Interrogation_Position=1555; Antisense; ATGGGCTCCCAGTCTCAGATTAAGA
>probe:Drosophila_2:1635759_at:519:687; Interrogation_Position=1586; Antisense; TATATCTATACAACTCCGAACCCAG
>probe:Drosophila_2:1635759_at:430:73; Interrogation_Position=1618; Antisense; AGGAACATGGATCCCCTGATTTGGT
>probe:Drosophila_2:1635759_at:22:601; Interrogation_Position=1751; Antisense; TGTATTTCGACATGCAGGCGGGCTT
>probe:Drosophila_2:1635759_at:490:343; Interrogation_Position=1772; Antisense; GCTTGAGCCCCGAAAGTGCATCCAA
>probe:Drosophila_2:1635759_at:568:369; Interrogation_Position=1809; Antisense; GAAGGCCAACTTTAGCTTTAGCAAT

Paste this into a BLAST search page for me
GGAAATGAAGTTCGCCCACATCACTGATGGCCACATATTTGGATCCGAGATAAGCAAGCATTTTTCACCGAACGTGTTGGTGGCCAATGAAGTTCTGCTTAAGTTCTGCTTCAGCTCGCTGGAGTAGGATTGCAATGGTCAGCCACCGCTTGTCATCCACATCGTCCCAGAAGAAGAACGACGAACACTCAACAGCCAAAATGGGCTCCCAGTCTCAGATTAAGATATATCTATACAACTCCGAACCCAGAGGAACATGGATCCCCTGATTTGGTTGTATTTCGACATGCAGGCGGGCTTGCTTGAGCCCCGAAAGTGCATCCAAGAAGGCCAACTTTAGCTTTAGCAAT

Full Affymetrix probeset data:

Annotations for 1635759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720