FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635760_at:

>probe:Drosophila_2:1635760_at:644:27; Interrogation_Position=1414; Antisense; ATACCGAACATTCATCTACTGGCCT
>probe:Drosophila_2:1635760_at:217:143; Interrogation_Position=1431; Antisense; ACTGGCCTCCATTGATCACATAAAT
>probe:Drosophila_2:1635760_at:489:709; Interrogation_Position=1492; Antisense; TTCAACTTCTCGTGGTGGGACTGCA
>probe:Drosophila_2:1635760_at:531:527; Interrogation_Position=1508; Antisense; GGGACTGCACAACAATGCTGCCATA
>probe:Drosophila_2:1635760_at:602:717; Interrogation_Position=1549; Antisense; TTCGAGAACTCGCTGCTGGTGCAGA
>probe:Drosophila_2:1635760_at:423:51; Interrogation_Position=1600; Antisense; ATGCGCAGTGTCTTCTCATCGCTAA
>probe:Drosophila_2:1635760_at:490:413; Interrogation_Position=1626; Antisense; GACCAATTCGCGTGGCATTTACATG
>probe:Drosophila_2:1635760_at:341:83; Interrogation_Position=1697; Antisense; AGGGCATGCCGTTCAGGGATCTCTA
>probe:Drosophila_2:1635760_at:2:529; Interrogation_Position=1712; Antisense; GGGATCTCTATTCGAGTTGTCGCGA
>probe:Drosophila_2:1635760_at:157:703; Interrogation_Position=1742; Antisense; TTTTGGTCAGCTCAGATCTGGCACT
>probe:Drosophila_2:1635760_at:454:121; Interrogation_Position=1819; Antisense; AGCGTTGATGGCTCCGAACAGCTAA
>probe:Drosophila_2:1635760_at:295:385; Interrogation_Position=1834; Antisense; GAACAGCTAACCATTCCCATTGATG
>probe:Drosophila_2:1635760_at:334:143; Interrogation_Position=1863; Antisense; ACTGCTGCAGCAGTTTCTCGAGGAG
>probe:Drosophila_2:1635760_at:363:579; Interrogation_Position=1902; Antisense; GGCCATCGGCGTAATTTTAGAACAT

Paste this into a BLAST search page for me
ATACCGAACATTCATCTACTGGCCTACTGGCCTCCATTGATCACATAAATTTCAACTTCTCGTGGTGGGACTGCAGGGACTGCACAACAATGCTGCCATATTCGAGAACTCGCTGCTGGTGCAGAATGCGCAGTGTCTTCTCATCGCTAAGACCAATTCGCGTGGCATTTACATGAGGGCATGCCGTTCAGGGATCTCTAGGGATCTCTATTCGAGTTGTCGCGATTTTGGTCAGCTCAGATCTGGCACTAGCGTTGATGGCTCCGAACAGCTAAGAACAGCTAACCATTCCCATTGATGACTGCTGCAGCAGTTTCTCGAGGAGGGCCATCGGCGTAATTTTAGAACAT

Full Affymetrix probeset data:

Annotations for 1635760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720