Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635762_at:

>probe:Drosophila_2:1635762_at:40:357; Interrogation_Position=1031; Antisense; GAATTCCCGAAGTGCTACCCAAGAG
>probe:Drosophila_2:1635762_at:243:397; Interrogation_Position=1078; Antisense; GAAATTGATGCCATTTACGCAGCGA
>probe:Drosophila_2:1635762_at:300:463; Interrogation_Position=1101; Antisense; GATTCTAATTGCCATCGACCGTCAT
>probe:Drosophila_2:1635762_at:567:291; Interrogation_Position=1116; Antisense; CGACCGTCATCGAAAGAGTTCCTTT
>probe:Drosophila_2:1635762_at:723:467; Interrogation_Position=1133; Antisense; GTTCCTTTAAGGTTAGTCCATCAGT
>probe:Drosophila_2:1635762_at:464:11; Interrogation_Position=1169; Antisense; ATTTGGCCTCGGACGCTAATGGAAA
>probe:Drosophila_2:1635762_at:408:667; Interrogation_Position=1287; Antisense; TACAGAGCCCGTAATGTGTCCATAT
>probe:Drosophila_2:1635762_at:393:77; Interrogation_Position=1349; Antisense; AGGATGTTGCCCTTCGCACAGTAAA
>probe:Drosophila_2:1635762_at:277:661; Interrogation_Position=1391; Antisense; TAAATGAACGCTCTTTCACCACTAG
>probe:Drosophila_2:1635762_at:650:139; Interrogation_Position=1442; Antisense; ACGGATCCTGGTTTCTGGTGTTCTT
>probe:Drosophila_2:1635762_at:108:687; Interrogation_Position=1480; Antisense; TTCTTAATGCGCTTGCTGGAGCTTT
>probe:Drosophila_2:1635762_at:512:585; Interrogation_Position=1496; Antisense; TGGAGCTTTGGCGTCCTCGGAAACA
>probe:Drosophila_2:1635762_at:358:485; Interrogation_Position=1547; Antisense; GTAGGGCCAGCTAGCAAACACCAAA
>probe:Drosophila_2:1635762_at:580:273; Interrogation_Position=1579; Antisense; CATTCTTCCATCAACTAGCCAATTA

Paste this into a BLAST search page for me
GAATTCCCGAAGTGCTACCCAAGAGGAAATTGATGCCATTTACGCAGCGAGATTCTAATTGCCATCGACCGTCATCGACCGTCATCGAAAGAGTTCCTTTGTTCCTTTAAGGTTAGTCCATCAGTATTTGGCCTCGGACGCTAATGGAAATACAGAGCCCGTAATGTGTCCATATAGGATGTTGCCCTTCGCACAGTAAATAAATGAACGCTCTTTCACCACTAGACGGATCCTGGTTTCTGGTGTTCTTTTCTTAATGCGCTTGCTGGAGCTTTTGGAGCTTTGGCGTCCTCGGAAACAGTAGGGCCAGCTAGCAAACACCAAACATTCTTCCATCAACTAGCCAATTA

Full Affymetrix probeset data:

Annotations for 1635762_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime