FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635763_at:

>probe:Drosophila_2:1635763_at:442:237; Interrogation_Position=233; Antisense; AATCGGACTCATACTACGGCGGCAG
>probe:Drosophila_2:1635763_at:626:139; Interrogation_Position=248; Antisense; ACGGCGGCAGTTATCCTAGCTACGG
>probe:Drosophila_2:1635763_at:2:675; Interrogation_Position=264; Antisense; TAGCTACGGATACAGGCCCAACTAT
>probe:Drosophila_2:1635763_at:385:661; Interrogation_Position=313; Antisense; TATAACTATGGATACCCGGTCTTCG
>probe:Drosophila_2:1635763_at:18:715; Interrogation_Position=334; Antisense; TTCGGCTACGGCTATGGGCAGAACT
>probe:Drosophila_2:1635763_at:649:567; Interrogation_Position=350; Antisense; GGCAGAACTACTACAGACCCAGCTA
>probe:Drosophila_2:1635763_at:394:425; Interrogation_Position=396; Antisense; GAGACCGCAGCCCTATTATGGTTAC
>probe:Drosophila_2:1635763_at:439:27; Interrogation_Position=431; Antisense; ATAGCTCCAGTGGAACTGCCGGATC
>probe:Drosophila_2:1635763_at:90:541; Interrogation_Position=460; Antisense; GGTTATCCCTCATACAGCAGTTCAG
>probe:Drosophila_2:1635763_at:103:115; Interrogation_Position=475; Antisense; AGCAGTTCAGCTGTCATCTCAAGCT
>probe:Drosophila_2:1635763_at:579:193; Interrogation_Position=495; Antisense; AAGCTCTCCAACAAATTCGGCCGTT
>probe:Drosophila_2:1635763_at:70:111; Interrogation_Position=581; Antisense; AGCAAGCCCAGTTAGCCGGTCTTTT
>probe:Drosophila_2:1635763_at:484:357; Interrogation_Position=682; Antisense; GCAAATCCACAAGCGCTGAGCGGTC
>probe:Drosophila_2:1635763_at:427:609; Interrogation_Position=698; Antisense; TGAGCGGTCTACTCAGTCTGCTTGG

Paste this into a BLAST search page for me
AATCGGACTCATACTACGGCGGCAGACGGCGGCAGTTATCCTAGCTACGGTAGCTACGGATACAGGCCCAACTATTATAACTATGGATACCCGGTCTTCGTTCGGCTACGGCTATGGGCAGAACTGGCAGAACTACTACAGACCCAGCTAGAGACCGCAGCCCTATTATGGTTACATAGCTCCAGTGGAACTGCCGGATCGGTTATCCCTCATACAGCAGTTCAGAGCAGTTCAGCTGTCATCTCAAGCTAAGCTCTCCAACAAATTCGGCCGTTAGCAAGCCCAGTTAGCCGGTCTTTTGCAAATCCACAAGCGCTGAGCGGTCTGAGCGGTCTACTCAGTCTGCTTGG

Full Affymetrix probeset data:

Annotations for 1635763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720