FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635764_at:

>probe:Drosophila_2:1635764_at:253:645; Interrogation_Position=1030; Antisense; TCACCCAACTTTCAGGAGGACGTCA
>probe:Drosophila_2:1635764_at:31:57; Interrogation_Position=1058; Antisense; ATGAGCAATTCGAGTCCAACACCTT
>probe:Drosophila_2:1635764_at:605:95; Interrogation_Position=1090; Antisense; AGATATCCCGTCTATCCATTTGATG
>probe:Drosophila_2:1635764_at:509:565; Interrogation_Position=1143; Antisense; GGCAGCTAATTTTCCCAGTCTTTAT
>probe:Drosophila_2:1635764_at:462:301; Interrogation_Position=1156; Antisense; CCCAGTCTTTATCCCAAGGCAGAGG
>probe:Drosophila_2:1635764_at:478:47; Interrogation_Position=1187; Antisense; ATCCTGCTACGCCTGTGAAATTCAC
>probe:Drosophila_2:1635764_at:420:629; Interrogation_Position=1278; Antisense; TCCGCCAGGCGGTAATTTTGAGGTG
>probe:Drosophila_2:1635764_at:422:543; Interrogation_Position=1306; Antisense; GGATTCAGTATACCACCAGACTATA
>probe:Drosophila_2:1635764_at:497:103; Interrogation_Position=1323; Antisense; AGACTATAAACCCACGCCTAGTGCT
>probe:Drosophila_2:1635764_at:710:77; Interrogation_Position=848; Antisense; AGGATCCCATTCGAGTTAGCTACAC
>probe:Drosophila_2:1635764_at:32:707; Interrogation_Position=863; Antisense; TTAGCTACACATTGCGATTCATCGC
>probe:Drosophila_2:1635764_at:652:211; Interrogation_Position=889; Antisense; AAGACCTTCAAGCTGCACGGTGGTG
>probe:Drosophila_2:1635764_at:584:573; Interrogation_Position=913; Antisense; GGCGACTTGGTCATGGACTTTCCAA
>probe:Drosophila_2:1635764_at:421:303; Interrogation_Position=955; Antisense; CCGCTGCTGGGAAGTGCTGATGACA

Paste this into a BLAST search page for me
TCACCCAACTTTCAGGAGGACGTCAATGAGCAATTCGAGTCCAACACCTTAGATATCCCGTCTATCCATTTGATGGGCAGCTAATTTTCCCAGTCTTTATCCCAGTCTTTATCCCAAGGCAGAGGATCCTGCTACGCCTGTGAAATTCACTCCGCCAGGCGGTAATTTTGAGGTGGGATTCAGTATACCACCAGACTATAAGACTATAAACCCACGCCTAGTGCTAGGATCCCATTCGAGTTAGCTACACTTAGCTACACATTGCGATTCATCGCAAGACCTTCAAGCTGCACGGTGGTGGGCGACTTGGTCATGGACTTTCCAACCGCTGCTGGGAAGTGCTGATGACA

Full Affymetrix probeset data:

Annotations for 1635764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720