FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635767_at:

>probe:Drosophila_2:1635767_at:198:103; Interrogation_Position=1648; Antisense; AGAGCTTACTGGAACTTGCTGCGCT
>probe:Drosophila_2:1635767_at:195:69; Interrogation_Position=1676; Antisense; ATGGCTCTCCAGATACCCAGAAGCA
>probe:Drosophila_2:1635767_at:459:377; Interrogation_Position=1695; Antisense; GAAGCAGCGGAATCAGGCCAATGCA
>probe:Drosophila_2:1635767_at:78:111; Interrogation_Position=1727; Antisense; AGCACCTGGAGTCCAATCGGCAGGT
>probe:Drosophila_2:1635767_at:481:237; Interrogation_Position=1741; Antisense; AATCGGCAGGTGAAGGCCACGACGT
>probe:Drosophila_2:1635767_at:208:409; Interrogation_Position=1761; Antisense; GACGTGACTCCGACAGATGCCTTAA
>probe:Drosophila_2:1635767_at:234:631; Interrogation_Position=1797; Antisense; TCCTCCGTCCTAGCGGGATATGATA
>probe:Drosophila_2:1635767_at:118:421; Interrogation_Position=1852; Antisense; GAGAAGTACCCAAATGTCATGTTGA
>probe:Drosophila_2:1635767_at:184:655; Interrogation_Position=1888; Antisense; TAAGAAAAAATTCCTTGATCCCCTG
>probe:Drosophila_2:1635767_at:647:447; Interrogation_Position=1904; Antisense; GATCCCCTGGTGATTATAGTGCCTC
>probe:Drosophila_2:1635767_at:116:87; Interrogation_Position=1921; Antisense; AGTGCCTCCAAAAAAGATTTCTAGT
>probe:Drosophila_2:1635767_at:352:459; Interrogation_Position=1936; Antisense; GATTTCTAGTCACATGATCCGGCCG
>probe:Drosophila_2:1635767_at:316:721; Interrogation_Position=2145; Antisense; TTGCTTGTCGCTAATTATTGTACCA
>probe:Drosophila_2:1635767_at:33:571; Interrogation_Position=2186; Antisense; TCCTTATATGGATACGCCCTTTCTA

Paste this into a BLAST search page for me
AGAGCTTACTGGAACTTGCTGCGCTATGGCTCTCCAGATACCCAGAAGCAGAAGCAGCGGAATCAGGCCAATGCAAGCACCTGGAGTCCAATCGGCAGGTAATCGGCAGGTGAAGGCCACGACGTGACGTGACTCCGACAGATGCCTTAATCCTCCGTCCTAGCGGGATATGATAGAGAAGTACCCAAATGTCATGTTGATAAGAAAAAATTCCTTGATCCCCTGGATCCCCTGGTGATTATAGTGCCTCAGTGCCTCCAAAAAAGATTTCTAGTGATTTCTAGTCACATGATCCGGCCGTTGCTTGTCGCTAATTATTGTACCATCCTTATATGGATACGCCCTTTCTA

Full Affymetrix probeset data:

Annotations for 1635767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720