FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635768_at:

>probe:Drosophila_2:1635768_at:361:507; Interrogation_Position=1811; Antisense; GTGCTGGGCTTCCTCAAGAACATAC
>probe:Drosophila_2:1635768_at:437:29; Interrogation_Position=1832; Antisense; ATACACAATCCGCAGTTCGTTAGCC
>probe:Drosophila_2:1635768_at:172:717; Interrogation_Position=1847; Antisense; TTCGTTAGCCGGTACGGTGTGCAGC
>probe:Drosophila_2:1635768_at:522:153; Interrogation_Position=1918; Antisense; ACAGATCTCAAGTGTCTTCACCGAC
>probe:Drosophila_2:1635768_at:335:601; Interrogation_Position=1968; Antisense; TGTACGCCTTCTGCATTGTGATGAT
>probe:Drosophila_2:1635768_at:582:1; Interrogation_Position=2008; Antisense; ATTGTTCGCCTTCAAGGGATACCGC
>probe:Drosophila_2:1635768_at:524:529; Interrogation_Position=2023; Antisense; GGGATACCGCAAGAAGCCCTATGGC
>probe:Drosophila_2:1635768_at:230:681; Interrogation_Position=2042; Antisense; TATGGCCACGATCTCCTGGGCAAGG
>probe:Drosophila_2:1635768_at:624:165; Interrogation_Position=2135; Antisense; AACGGAATTTAACACGCCACCTCAT
>probe:Drosophila_2:1635768_at:648:347; Interrogation_Position=2161; Antisense; GCATGATTTGTATTCGTGGCACCTA
>probe:Drosophila_2:1635768_at:361:483; Interrogation_Position=2229; Antisense; GTATGAACGAACAGTCCTCTTCCAG
>probe:Drosophila_2:1635768_at:590:701; Interrogation_Position=2248; Antisense; TTCCAGTTGTAGTCCCTAACCTAAT
>probe:Drosophila_2:1635768_at:212:701; Interrogation_Position=2276; Antisense; TTTTTACCACGACGATGCACCTGAT
>probe:Drosophila_2:1635768_at:66:359; Interrogation_Position=2319; Antisense; GCAAATGTGATTTTTCCCTCCAGAA

Paste this into a BLAST search page for me
GTGCTGGGCTTCCTCAAGAACATACATACACAATCCGCAGTTCGTTAGCCTTCGTTAGCCGGTACGGTGTGCAGCACAGATCTCAAGTGTCTTCACCGACTGTACGCCTTCTGCATTGTGATGATATTGTTCGCCTTCAAGGGATACCGCGGGATACCGCAAGAAGCCCTATGGCTATGGCCACGATCTCCTGGGCAAGGAACGGAATTTAACACGCCACCTCATGCATGATTTGTATTCGTGGCACCTAGTATGAACGAACAGTCCTCTTCCAGTTCCAGTTGTAGTCCCTAACCTAATTTTTTACCACGACGATGCACCTGATGCAAATGTGATTTTTCCCTCCAGAA

Full Affymetrix probeset data:

Annotations for 1635768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720