Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635769_at:

>probe:Drosophila_2:1635769_at:472:499; Interrogation_Position=2555; Antisense; GTCTGGGAGCTGTTCGTCAACGAAT
>probe:Drosophila_2:1635769_at:549:255; Interrogation_Position=2599; Antisense; CAAACTGATGTATGGCCTGTCTGCC
>probe:Drosophila_2:1635769_at:470:633; Interrogation_Position=2632; Antisense; TCCCTGGATTTTGCAGCGCTACATT
>probe:Drosophila_2:1635769_at:89:341; Interrogation_Position=2649; Antisense; GCTACATTGACCTGGCGTGGAACGA
>probe:Drosophila_2:1635769_at:369:707; Interrogation_Position=2709; Antisense; TTACCTACATCTCTGCGAATCCAGT
>probe:Drosophila_2:1635769_at:669:621; Interrogation_Position=2722; Antisense; TGCGAATCCAGTTGGTGAGTCCCTG
>probe:Drosophila_2:1635769_at:237:555; Interrogation_Position=2785; Antisense; GGACCGATTCGGACTCAACGAGCGT
>probe:Drosophila_2:1635769_at:382:649; Interrogation_Position=2799; Antisense; TCAACGAGCGTTATTTGGGCAACCT
>probe:Drosophila_2:1635769_at:591:1; Interrogation_Position=2811; Antisense; ATTTGGGCAACCTGATTCCCTCGAT
>probe:Drosophila_2:1635769_at:334:699; Interrogation_Position=2846; Antisense; TTTAGCACCCAAACCAAGCTGGAGG
>probe:Drosophila_2:1635769_at:129:553; Interrogation_Position=2875; Antisense; GGAGCAATTCTTCGCCAAATATCCG
>probe:Drosophila_2:1635769_at:165:283; Interrogation_Position=2919; Antisense; CTGCCCGGGTGAGAGCTCTGGAAAC
>probe:Drosophila_2:1635769_at:316:187; Interrogation_Position=2951; Antisense; AACAACATTGTTTGGCTGGCCGAGA
>probe:Drosophila_2:1635769_at:164:535; Interrogation_Position=3035; Antisense; GGTCTTGCGACCATGGTTACCATTA

Paste this into a BLAST search page for me
GTCTGGGAGCTGTTCGTCAACGAATCAAACTGATGTATGGCCTGTCTGCCTCCCTGGATTTTGCAGCGCTACATTGCTACATTGACCTGGCGTGGAACGATTACCTACATCTCTGCGAATCCAGTTGCGAATCCAGTTGGTGAGTCCCTGGGACCGATTCGGACTCAACGAGCGTTCAACGAGCGTTATTTGGGCAACCTATTTGGGCAACCTGATTCCCTCGATTTTAGCACCCAAACCAAGCTGGAGGGGAGCAATTCTTCGCCAAATATCCGCTGCCCGGGTGAGAGCTCTGGAAACAACAACATTGTTTGGCTGGCCGAGAGGTCTTGCGACCATGGTTACCATTA

Full Affymetrix probeset data:

Annotations for 1635769_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime