FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635770_at:

>probe:Drosophila_2:1635770_at:420:199; Interrogation_Position=1018; Antisense; AACCGCGGACTCTTCAACTTCGAAG
>probe:Drosophila_2:1635770_at:534:681; Interrogation_Position=495; Antisense; TATGGAGCACATGCGACTCTCTCTT
>probe:Drosophila_2:1635770_at:215:405; Interrogation_Position=509; Antisense; GACTCTCTCTTCGTAAATTGGCCGA
>probe:Drosophila_2:1635770_at:350:619; Interrogation_Position=536; Antisense; TGCATGCCGCCAGTGTGATATACAA
>probe:Drosophila_2:1635770_at:159:485; Interrogation_Position=567; Antisense; GTATGGACCATATCACGCTGACTTT
>probe:Drosophila_2:1635770_at:689:429; Interrogation_Position=694; Antisense; GAGTGCTACCTTAAGAATTTCCCCA
>probe:Drosophila_2:1635770_at:608:109; Interrogation_Position=707; Antisense; AGAATTTCCCCACTACTGAGCAGTA
>probe:Drosophila_2:1635770_at:299:361; Interrogation_Position=734; Antisense; GCAAGCTCTGTTTGGAGTCCCTCAA
>probe:Drosophila_2:1635770_at:718:87; Interrogation_Position=749; Antisense; AGTCCCTCAATGTAGATCCCCAGGA
>probe:Drosophila_2:1635770_at:251:641; Interrogation_Position=802; Antisense; TCTCCCTCCAACATTCTTTTTAAGT
>probe:Drosophila_2:1635770_at:370:319; Interrogation_Position=841; Antisense; GCCCCAACATTCTTTGCCGTAATGA
>probe:Drosophila_2:1635770_at:415:543; Interrogation_Position=879; Antisense; GGATTTGCTGCCAGTTTGCAAGGAA
>probe:Drosophila_2:1635770_at:371:489; Interrogation_Position=963; Antisense; GTACACCAATCCCATCTTTGTGGAA
>probe:Drosophila_2:1635770_at:424:225; Interrogation_Position=994; Antisense; AAGGAGCTGTATCCCATTTGCTGCA

Paste this into a BLAST search page for me
AACCGCGGACTCTTCAACTTCGAAGTATGGAGCACATGCGACTCTCTCTTGACTCTCTCTTCGTAAATTGGCCGATGCATGCCGCCAGTGTGATATACAAGTATGGACCATATCACGCTGACTTTGAGTGCTACCTTAAGAATTTCCCCAAGAATTTCCCCACTACTGAGCAGTAGCAAGCTCTGTTTGGAGTCCCTCAAAGTCCCTCAATGTAGATCCCCAGGATCTCCCTCCAACATTCTTTTTAAGTGCCCCAACATTCTTTGCCGTAATGAGGATTTGCTGCCAGTTTGCAAGGAAGTACACCAATCCCATCTTTGTGGAAAAGGAGCTGTATCCCATTTGCTGCA

Full Affymetrix probeset data:

Annotations for 1635770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720