Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635772_at:

>probe:Drosophila_2:1635772_at:260:505; Interrogation_Position=1312; Antisense; GTCCTGCTGGCTCTGAATATGAACA
>probe:Drosophila_2:1635772_at:582:643; Interrogation_Position=1364; Antisense; TCTACTCGTTCGATTATGCGGGCGA
>probe:Drosophila_2:1635772_at:408:49; Interrogation_Position=1379; Antisense; ATGCGGGCGAGTTTAATCGTTACAA
>probe:Drosophila_2:1635772_at:433:191; Interrogation_Position=1423; Antisense; AACTTGCAGAGTCCCTTCAAGGCGG
>probe:Drosophila_2:1635772_at:236:545; Interrogation_Position=1518; Antisense; GGATCAGTCGATGGCTCACCGGATG
>probe:Drosophila_2:1635772_at:277:261; Interrogation_Position=1534; Antisense; CACCGGATGGTGGAGCTTTGGACAA
>probe:Drosophila_2:1635772_at:472:81; Interrogation_Position=1570; Antisense; AGTGGTAATCCGTTGGGATCCGCTC
>probe:Drosophila_2:1635772_at:267:93; Interrogation_Position=1685; Antisense; AGTTCTCCGCCACGTTGAGCGATGA
>probe:Drosophila_2:1635772_at:427:567; Interrogation_Position=1718; Antisense; GGCACAGTCTGATCCGCGAAGTATA
>probe:Drosophila_2:1635772_at:246:373; Interrogation_Position=1735; Antisense; GAAGTATACTATTTGCGAAGCCGCA
>probe:Drosophila_2:1635772_at:336:353; Interrogation_Position=1757; Antisense; GCAGCCGAAAGCGAGCTCTAAACAA
>probe:Drosophila_2:1635772_at:232:177; Interrogation_Position=1780; Antisense; AAACGTCGAAAACAGCTGGCCAAAT
>probe:Drosophila_2:1635772_at:204:165; Interrogation_Position=1824; Antisense; AAATCCGAAACTCGGCGGGCGCAAG
>probe:Drosophila_2:1635772_at:727:359; Interrogation_Position=1844; Antisense; GCAAGAGCCTAGTTAAGCGGCCAAA

Paste this into a BLAST search page for me
GTCCTGCTGGCTCTGAATATGAACATCTACTCGTTCGATTATGCGGGCGAATGCGGGCGAGTTTAATCGTTACAAAACTTGCAGAGTCCCTTCAAGGCGGGGATCAGTCGATGGCTCACCGGATGCACCGGATGGTGGAGCTTTGGACAAAGTGGTAATCCGTTGGGATCCGCTCAGTTCTCCGCCACGTTGAGCGATGAGGCACAGTCTGATCCGCGAAGTATAGAAGTATACTATTTGCGAAGCCGCAGCAGCCGAAAGCGAGCTCTAAACAAAAACGTCGAAAACAGCTGGCCAAATAAATCCGAAACTCGGCGGGCGCAAGGCAAGAGCCTAGTTAAGCGGCCAAA

Full Affymetrix probeset data:

Annotations for 1635772_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime