FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635773_at:

>probe:Drosophila_2:1635773_at:8:15; Interrogation_Position=3381; Antisense; ATTACCAAATCTCTGCTGCACGAGG
>probe:Drosophila_2:1635773_at:566:439; Interrogation_Position=3402; Antisense; GAGGCCTCACAGCATATCGATCTGC
>probe:Drosophila_2:1635773_at:685:195; Interrogation_Position=3527; Antisense; AACGGAGGCTTTGCGAGCATCTGCT
>probe:Drosophila_2:1635773_at:501:587; Interrogation_Position=3551; Antisense; TGGAGCCCTGTGTCAAGATCTTCAC
>probe:Drosophila_2:1635773_at:223:375; Interrogation_Position=3578; Antisense; GAAGTTCGTCAAGCGCTATCAGCAT
>probe:Drosophila_2:1635773_at:181:51; Interrogation_Position=3601; Antisense; ATGCGCATCGTGGACTTTGGGTGAC
>probe:Drosophila_2:1635773_at:455:171; Interrogation_Position=3632; Antisense; AAAGTGCTCCATGTGTCGCCAAAGG
>probe:Drosophila_2:1635773_at:683:599; Interrogation_Position=3658; Antisense; TGTACGATCACAGCCAGGTGCTAAT
>probe:Drosophila_2:1635773_at:102:109; Interrogation_Position=3746; Antisense; AGAATGTCCACGGTGCTTTACGGCC
>probe:Drosophila_2:1635773_at:494:617; Interrogation_Position=3759; Antisense; TGCTTTACGGCCATTCCAGATCAAA
>probe:Drosophila_2:1635773_at:35:257; Interrogation_Position=3780; Antisense; CAAAGTATTGGTTTGCCGCGGCCAA
>probe:Drosophila_2:1635773_at:484:165; Interrogation_Position=3809; Antisense; AAATCTAATCAGCATTTCCTCGTCC
>probe:Drosophila_2:1635773_at:350:637; Interrogation_Position=3828; Antisense; TCGTCCTTGGAAATGGGTGCCTTGC
>probe:Drosophila_2:1635773_at:103:679; Interrogation_Position=3882; Antisense; TAGTTTCATCGTCCTTTTTGTATAT

Paste this into a BLAST search page for me
ATTACCAAATCTCTGCTGCACGAGGGAGGCCTCACAGCATATCGATCTGCAACGGAGGCTTTGCGAGCATCTGCTTGGAGCCCTGTGTCAAGATCTTCACGAAGTTCGTCAAGCGCTATCAGCATATGCGCATCGTGGACTTTGGGTGACAAAGTGCTCCATGTGTCGCCAAAGGTGTACGATCACAGCCAGGTGCTAATAGAATGTCCACGGTGCTTTACGGCCTGCTTTACGGCCATTCCAGATCAAACAAAGTATTGGTTTGCCGCGGCCAAAAATCTAATCAGCATTTCCTCGTCCTCGTCCTTGGAAATGGGTGCCTTGCTAGTTTCATCGTCCTTTTTGTATAT

Full Affymetrix probeset data:

Annotations for 1635773_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720