Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635774_at:

>probe:Drosophila_2:1635774_at:299:205; Interrogation_Position=1442; Antisense; AAGCGCCTATGGAATGAACTGCCCT
>probe:Drosophila_2:1635774_at:677:229; Interrogation_Position=1454; Antisense; AATGAACTGCCCTGTCCGGATCGAG
>probe:Drosophila_2:1635774_at:182:203; Interrogation_Position=1484; Antisense; AACCTGCTCACCAACGGTGTAGTAA
>probe:Drosophila_2:1635774_at:449:365; Interrogation_Position=1510; Antisense; GAATACCAAACGAATGCGCTTCCAG
>probe:Drosophila_2:1635774_at:413:489; Interrogation_Position=1541; Antisense; GTACTCACACTTGACGACGAGGATT
>probe:Drosophila_2:1635774_at:52:437; Interrogation_Position=1566; Antisense; GAGGATTCCAGATGTGGCACTGCTT
>probe:Drosophila_2:1635774_at:408:723; Interrogation_Position=1589; Antisense; TTGCTGGCAGTTTTTGATCTCCTTG
>probe:Drosophila_2:1635774_at:704:451; Interrogation_Position=1604; Antisense; GATCTCCTTGTTAGATTTTCGCGCC
>probe:Drosophila_2:1635774_at:14:703; Interrogation_Position=1619; Antisense; TTTTCGCGCCGCAGCAATCAAAGAT
>probe:Drosophila_2:1635774_at:554:567; Interrogation_Position=1783; Antisense; GGCAGACTGAATTTGTCCGTTCACA
>probe:Drosophila_2:1635774_at:574:17; Interrogation_Position=1813; Antisense; ATTTAACAAGTGTCTGTTCCCACCG
>probe:Drosophila_2:1635774_at:338:511; Interrogation_Position=1822; Antisense; GTGTCTGTTCCCACCGAAAGAAGTA
>probe:Drosophila_2:1635774_at:471:385; Interrogation_Position=1892; Antisense; GAACACCCTAAAGGCCAATGTCTAT
>probe:Drosophila_2:1635774_at:711:131; Interrogation_Position=1990; Antisense; ACGCCCACTAAATTGGCAACCATTT

Paste this into a BLAST search page for me
AAGCGCCTATGGAATGAACTGCCCTAATGAACTGCCCTGTCCGGATCGAGAACCTGCTCACCAACGGTGTAGTAAGAATACCAAACGAATGCGCTTCCAGGTACTCACACTTGACGACGAGGATTGAGGATTCCAGATGTGGCACTGCTTTTGCTGGCAGTTTTTGATCTCCTTGGATCTCCTTGTTAGATTTTCGCGCCTTTTCGCGCCGCAGCAATCAAAGATGGCAGACTGAATTTGTCCGTTCACAATTTAACAAGTGTCTGTTCCCACCGGTGTCTGTTCCCACCGAAAGAAGTAGAACACCCTAAAGGCCAATGTCTATACGCCCACTAAATTGGCAACCATTT

Full Affymetrix probeset data:

Annotations for 1635774_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime