FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635777_at:

>probe:Drosophila_2:1635777_at:442:221; Interrogation_Position=107; Antisense; AAGTGGGCACTGTGCTGAGACTCCT
>probe:Drosophila_2:1635777_at:600:413; Interrogation_Position=192; Antisense; GACCAGTGGCGAAGTGCATTTGACT
>probe:Drosophila_2:1635777_at:184:665; Interrogation_Position=216; Antisense; TAAATTTTTGCCACACGTCTCGCAA
>probe:Drosophila_2:1635777_at:219:139; Interrogation_Position=230; Antisense; ACGTCTCGCAACTGCTCATGGAAAG
>probe:Drosophila_2:1635777_at:680:389; Interrogation_Position=254; Antisense; GAAAAATGGAGCCTGCTCCGCCAGA
>probe:Drosophila_2:1635777_at:546:99; Interrogation_Position=276; Antisense; AGAGAAAATTCTCCAGGCCTTTAAG
>probe:Drosophila_2:1635777_at:710:573; Interrogation_Position=367; Antisense; GGCGAGCCTTTCACCCAAGAGGAAA
>probe:Drosophila_2:1635777_at:48:579; Interrogation_Position=403; Antisense; TGGCCAGTGGCCATAGACCCAATTA
>probe:Drosophila_2:1635777_at:574:675; Interrogation_Position=426; Antisense; TAGCGGACACATACCCTATGAGTTC
>probe:Drosophila_2:1635777_at:684:365; Interrogation_Position=456; Antisense; GAATCAGCTCATGGTAGCCGGCAAA
>probe:Drosophila_2:1635777_at:397:273; Interrogation_Position=48; Antisense; CATTTCGGATGCCTTTTGTGTGTTC
>probe:Drosophila_2:1635777_at:521:75; Interrogation_Position=563; Antisense; AGGAGCCGCTGCATCGGGAGTTCTA
>probe:Drosophila_2:1635777_at:300:725; Interrogation_Position=63; Antisense; TTGTGTGTTCGATCATCATGGCGAC
>probe:Drosophila_2:1635777_at:177:269; Interrogation_Position=79; Antisense; CATGGCGACAAGTTCATCGACGTTA

Paste this into a BLAST search page for me
AAGTGGGCACTGTGCTGAGACTCCTGACCAGTGGCGAAGTGCATTTGACTTAAATTTTTGCCACACGTCTCGCAAACGTCTCGCAACTGCTCATGGAAAGGAAAAATGGAGCCTGCTCCGCCAGAAGAGAAAATTCTCCAGGCCTTTAAGGGCGAGCCTTTCACCCAAGAGGAAATGGCCAGTGGCCATAGACCCAATTATAGCGGACACATACCCTATGAGTTCGAATCAGCTCATGGTAGCCGGCAAACATTTCGGATGCCTTTTGTGTGTTCAGGAGCCGCTGCATCGGGAGTTCTATTGTGTGTTCGATCATCATGGCGACCATGGCGACAAGTTCATCGACGTTA

Full Affymetrix probeset data:

Annotations for 1635777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720