FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635778_at:

>probe:Drosophila_2:1635778_at:240:297; Interrogation_Position=4980; Antisense; CGCTTCGCAAGCCATCTGTATAATT
>probe:Drosophila_2:1635778_at:492:295; Interrogation_Position=5012; Antisense; CGAACCTCGAAACGCTCTGGAAGCA
>probe:Drosophila_2:1635778_at:144:377; Interrogation_Position=5031; Antisense; GAAGCAAATCGTGCGTCGGGACATC
>probe:Drosophila_2:1635778_at:673:653; Interrogation_Position=5069; Antisense; TAATCTTCAACGAGTTCGTGCGCCG
>probe:Drosophila_2:1635778_at:153:255; Interrogation_Position=5112; Antisense; CAAAGAGAACCGTAGTCCCTGGCTA
>probe:Drosophila_2:1635778_at:669:339; Interrogation_Position=5133; Antisense; GCTACGACGAAAACACGGGCTCTGT
>probe:Drosophila_2:1635778_at:228:285; Interrogation_Position=5154; Antisense; CTGTAAGCTGAAGTGCGTGGACCCA
>probe:Drosophila_2:1635778_at:437:339; Interrogation_Position=5207; Antisense; GCTCAGAAATTGTGCGCCGCAGCAA
>probe:Drosophila_2:1635778_at:207:57; Interrogation_Position=5317; Antisense; ATGAGCAGCGATCTGAGTCCCATTG
>probe:Drosophila_2:1635778_at:402:5; Interrogation_Position=5338; Antisense; ATTGCGGCAGCTCAAGGTGCAGCCA
>probe:Drosophila_2:1635778_at:63:57; Interrogation_Position=5362; Antisense; ATGACGACGAGCTTGGATGGCCGAA
>probe:Drosophila_2:1635778_at:603:391; Interrogation_Position=5384; Antisense; GAAAGCGTTTGTATCCCGCTCAACA
>probe:Drosophila_2:1635778_at:227:553; Interrogation_Position=5520; Antisense; GGACTACCTTCAGTTGATGTCGGCC
>probe:Drosophila_2:1635778_at:36:443; Interrogation_Position=5535; Antisense; GATGTCGGCCCTCTTTAATGTAATG

Paste this into a BLAST search page for me
CGCTTCGCAAGCCATCTGTATAATTCGAACCTCGAAACGCTCTGGAAGCAGAAGCAAATCGTGCGTCGGGACATCTAATCTTCAACGAGTTCGTGCGCCGCAAAGAGAACCGTAGTCCCTGGCTAGCTACGACGAAAACACGGGCTCTGTCTGTAAGCTGAAGTGCGTGGACCCAGCTCAGAAATTGTGCGCCGCAGCAAATGAGCAGCGATCTGAGTCCCATTGATTGCGGCAGCTCAAGGTGCAGCCAATGACGACGAGCTTGGATGGCCGAAGAAAGCGTTTGTATCCCGCTCAACAGGACTACCTTCAGTTGATGTCGGCCGATGTCGGCCCTCTTTAATGTAATG

Full Affymetrix probeset data:

Annotations for 1635778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720