FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635779_at:

>probe:Drosophila_2:1635779_at:468:449; Interrogation_Position=175; Antisense; GATCCGGGCCTGAATGGCATCAGTG
>probe:Drosophila_2:1635779_at:681:397; Interrogation_Position=236; Antisense; GACAGAAGGGCGATGTCGGCCACCC
>probe:Drosophila_2:1635779_at:467:259; Interrogation_Position=256; Antisense; CACCCCGGAATGGATGTCTTCCAAA
>probe:Drosophila_2:1635779_at:555:477; Interrogation_Position=271; Antisense; GTCTTCCAAACCGTGAAGGGTCTGA
>probe:Drosophila_2:1635779_at:374:285; Interrogation_Position=292; Antisense; CTGAAGAGATCGGTGACAACGCTGC
>probe:Drosophila_2:1635779_at:178:613; Interrogation_Position=305; Antisense; TGACAACGCTGCATGGCGGCACGCT
>probe:Drosophila_2:1635779_at:677:375; Interrogation_Position=367; Antisense; GAAGCAGGCGTCAATGTATCCGCTT
>probe:Drosophila_2:1635779_at:334:601; Interrogation_Position=381; Antisense; TGTATCCGCTTCCACAGTCATAAAG
>probe:Drosophila_2:1635779_at:411:293; Interrogation_Position=477; Antisense; CGAGCGAGGACCACCAGGCGAAATC
>probe:Drosophila_2:1635779_at:659:235; Interrogation_Position=498; Antisense; AATCGGAGCGCAAGGACCACAGGGC
>probe:Drosophila_2:1635779_at:539:615; Interrogation_Position=567; Antisense; TGCACCTGGCACGAAGGGCGACAAG
>probe:Drosophila_2:1635779_at:174:43; Interrogation_Position=596; Antisense; ATCGAGGCGATCGTGGACTAACCAC
>probe:Drosophila_2:1635779_at:403:223; Interrogation_Position=628; Antisense; AAGGGTGACGAGTTCCCCACTGGCA
>probe:Drosophila_2:1635779_at:266:329; Interrogation_Position=676; Antisense; GCGGGACCACCTGATACACAGATTT

Paste this into a BLAST search page for me
GATCCGGGCCTGAATGGCATCAGTGGACAGAAGGGCGATGTCGGCCACCCCACCCCGGAATGGATGTCTTCCAAAGTCTTCCAAACCGTGAAGGGTCTGACTGAAGAGATCGGTGACAACGCTGCTGACAACGCTGCATGGCGGCACGCTGAAGCAGGCGTCAATGTATCCGCTTTGTATCCGCTTCCACAGTCATAAAGCGAGCGAGGACCACCAGGCGAAATCAATCGGAGCGCAAGGACCACAGGGCTGCACCTGGCACGAAGGGCGACAAGATCGAGGCGATCGTGGACTAACCACAAGGGTGACGAGTTCCCCACTGGCAGCGGGACCACCTGATACACAGATTT

Full Affymetrix probeset data:

Annotations for 1635779_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720