Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635783_a_at:

>probe:Drosophila_2:1635783_a_at:648:667; Interrogation_Position=149; Antisense; TACGATGTCAGCAGGGTGACGCCCT
>probe:Drosophila_2:1635783_a_at:539:77; Interrogation_Position=215; Antisense; AGGATTGAGGATGGTCCACCACCGC
>probe:Drosophila_2:1635783_a_at:126:133; Interrogation_Position=235; Antisense; ACCGCGCATTCTGTGCATGGTGCTC
>probe:Drosophila_2:1635783_a_at:66:65; Interrogation_Position=251; Antisense; ATGGTGCTCACCTGTCCGGAGAACG
>probe:Drosophila_2:1635783_a_at:313:423; Interrogation_Position=269; Antisense; GAGAACGTGCAGAGCCTGGCCAGAA
>probe:Drosophila_2:1635783_a_at:44:417; Interrogation_Position=280; Antisense; GAGCCTGGCCAGAAGTGTCTACGAG
>probe:Drosophila_2:1635783_a_at:656:113; Interrogation_Position=341; Antisense; AGCAGCGAGGACTACGAGCCACTGG
>probe:Drosophila_2:1635783_a_at:720:309; Interrogation_Position=386; Antisense; CCAACTGGCGGTGGCTACGAGGATC
>probe:Drosophila_2:1635783_a_at:158:663; Interrogation_Position=418; Antisense; TAAAACGCGCGAGGGATTCCGACAC
>probe:Drosophila_2:1635783_a_at:128:465; Interrogation_Position=432; Antisense; GATTCCGACACGTTTGGGAGCACTA
>probe:Drosophila_2:1635783_a_at:539:691; Interrogation_Position=444; Antisense; TTTGGGAGCACTACGCTGGCGACTA
>probe:Drosophila_2:1635783_a_at:166:287; Interrogation_Position=459; Antisense; CTGGCGACTACGATTGGTTCCTCAA
>probe:Drosophila_2:1635783_a_at:304:321; Interrogation_Position=553; Antisense; GCCCGTCTTCTTTGGCTACAAGATG
>probe:Drosophila_2:1635783_a_at:698:337; Interrogation_Position=94; Antisense; GCTCACTGGTTTCATGGCTGGATTC

Paste this into a BLAST search page for me
TACGATGTCAGCAGGGTGACGCCCTAGGATTGAGGATGGTCCACCACCGCACCGCGCATTCTGTGCATGGTGCTCATGGTGCTCACCTGTCCGGAGAACGGAGAACGTGCAGAGCCTGGCCAGAAGAGCCTGGCCAGAAGTGTCTACGAGAGCAGCGAGGACTACGAGCCACTGGCCAACTGGCGGTGGCTACGAGGATCTAAAACGCGCGAGGGATTCCGACACGATTCCGACACGTTTGGGAGCACTATTTGGGAGCACTACGCTGGCGACTACTGGCGACTACGATTGGTTCCTCAAGCCCGTCTTCTTTGGCTACAAGATGGCTCACTGGTTTCATGGCTGGATTC

Full Affymetrix probeset data:

Annotations for 1635783_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime