Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635784_a_at:

>probe:Drosophila_2:1635784_a_at:209:361; Interrogation_Position=125; Antisense; GCAAGGTCTTGGTCTGCAAAGTCTT
>probe:Drosophila_2:1635784_a_at:406:235; Interrogation_Position=156; Antisense; AATCCAGCTTTAATTCCACTTTATG
>probe:Drosophila_2:1635784_a_at:434:307; Interrogation_Position=171; Antisense; CCACTTTATGTGTGCGTTGGAGCGG
>probe:Drosophila_2:1635784_a_at:438:21; Interrogation_Position=18; Antisense; ATATAGTTCCATTCTGTTTTATTGG
>probe:Drosophila_2:1635784_a_at:5:519; Interrogation_Position=194; Antisense; GGGAGCTATTGGAGCCGTCTACTAT
>probe:Drosophila_2:1635784_a_at:334:643; Interrogation_Position=211; Antisense; TCTACTATATGGCTCGACTTGCTAC
>probe:Drosophila_2:1635784_a_at:95:403; Interrogation_Position=226; Antisense; GACTTGCTACTCGTAATCCCGATGT
>probe:Drosophila_2:1635784_a_at:534:233; Interrogation_Position=240; Antisense; AATCCCGATGTCACTTGGAATCGCA
>probe:Drosophila_2:1635784_a_at:411:585; Interrogation_Position=255; Antisense; TGGAATCGCACATCAAATCCCGAAC
>probe:Drosophila_2:1635784_a_at:446:233; Interrogation_Position=270; Antisense; AATCCCGAACCATGGCAAGAGTACA
>probe:Drosophila_2:1635784_a_at:399:9; Interrogation_Position=316; Antisense; ATTCGCCTGTGAGGGATTATTCCAA
>probe:Drosophila_2:1635784_a_at:337:177; Interrogation_Position=340; Antisense; AAACTAAGAGTGCTGCCCCAAACTT
>probe:Drosophila_2:1635784_a_at:483:29; Interrogation_Position=371; Antisense; ATAAATTACGTTTCCCTAGCAGCTG
>probe:Drosophila_2:1635784_a_at:525:291; Interrogation_Position=379; Antisense; CGTTTCCCTAGCAGCTGCAATTTAA

Paste this into a BLAST search page for me
GCAAGGTCTTGGTCTGCAAAGTCTTAATCCAGCTTTAATTCCACTTTATGCCACTTTATGTGTGCGTTGGAGCGGATATAGTTCCATTCTGTTTTATTGGGGGAGCTATTGGAGCCGTCTACTATTCTACTATATGGCTCGACTTGCTACGACTTGCTACTCGTAATCCCGATGTAATCCCGATGTCACTTGGAATCGCATGGAATCGCACATCAAATCCCGAACAATCCCGAACCATGGCAAGAGTACAATTCGCCTGTGAGGGATTATTCCAAAAACTAAGAGTGCTGCCCCAAACTTATAAATTACGTTTCCCTAGCAGCTGCGTTTCCCTAGCAGCTGCAATTTAA

Full Affymetrix probeset data:

Annotations for 1635784_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime