Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635787_at:

>probe:Drosophila_2:1635787_at:185:599; Interrogation_Position=1165; Antisense; TGTACACGATCCAGTCGGACAGCTA
>probe:Drosophila_2:1635787_at:375:289; Interrogation_Position=1180; Antisense; CGGACAGCTACTGGTCGAGTCTGAC
>probe:Drosophila_2:1635787_at:16:431; Interrogation_Position=1196; Antisense; GAGTCTGACCATCCATGTGCTGAAC
>probe:Drosophila_2:1635787_at:602:29; Interrogation_Position=1234; Antisense; ATAACTACAGGTGTCGCGCCAGGAA
>probe:Drosophila_2:1635787_at:103:453; Interrogation_Position=1260; Antisense; GATCTGGGCACCATCGAGAGGACCA
>probe:Drosophila_2:1635787_at:601:329; Interrogation_Position=1334; Antisense; GCGTGGCTTCAATTCAAACACCTTC
>probe:Drosophila_2:1635787_at:288:179; Interrogation_Position=1349; Antisense; AAACACCTTCGATGTGGTACTGAGT
>probe:Drosophila_2:1635787_at:47:539; Interrogation_Position=1364; Antisense; GGTACTGAGTGCTCCACGAGGTCCT
>probe:Drosophila_2:1635787_at:116:543; Interrogation_Position=1413; Antisense; GGATTCCGCATCGAGTACATGACCG
>probe:Drosophila_2:1635787_at:453:401; Interrogation_Position=1511; Antisense; TACCTTCCTTCTGACGAACTTAGAG
>probe:Drosophila_2:1635787_at:466:113; Interrogation_Position=1528; Antisense; ACTTAGAGCCAGATACCGTTTACCT
>probe:Drosophila_2:1635787_at:596:237; Interrogation_Position=1572; Antisense; AATCTGGCCGGATTCAGTGACTTCA
>probe:Drosophila_2:1635787_at:425:491; Interrogation_Position=1610; Antisense; GTACAAGACACTTTCGCTGGAGCCC
>probe:Drosophila_2:1635787_at:562:151; Interrogation_Position=1692; Antisense; ACACTAATGGTCCTGATGCGGCCGT

Paste this into a BLAST search page for me
TGTACACGATCCAGTCGGACAGCTACGGACAGCTACTGGTCGAGTCTGACGAGTCTGACCATCCATGTGCTGAACATAACTACAGGTGTCGCGCCAGGAAGATCTGGGCACCATCGAGAGGACCAGCGTGGCTTCAATTCAAACACCTTCAAACACCTTCGATGTGGTACTGAGTGGTACTGAGTGCTCCACGAGGTCCTGGATTCCGCATCGAGTACATGACCGTACCTTCCTTCTGACGAACTTAGAGACTTAGAGCCAGATACCGTTTACCTAATCTGGCCGGATTCAGTGACTTCAGTACAAGACACTTTCGCTGGAGCCCACACTAATGGTCCTGATGCGGCCGT

Full Affymetrix probeset data:

Annotations for 1635787_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime