Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635788_a_at:

>probe:Drosophila_2:1635788_a_at:187:639; Interrogation_Position=442; Antisense; TCGTGTGCCACCAGGATCTGTTCAG
>probe:Drosophila_2:1635788_a_at:38:453; Interrogation_Position=456; Antisense; GATCTGTTCAGCTCGGAGACCAAGT
>probe:Drosophila_2:1635788_a_at:136:547; Interrogation_Position=495; Antisense; GGATGGCCGGCCTTCAACGATGTCC
>probe:Drosophila_2:1635788_a_at:553:197; Interrogation_Position=565; Antisense; AACGTATACGCACTGAGGTCCGCTG
>probe:Drosophila_2:1635788_a_at:299:65; Interrogation_Position=609; Antisense; ATGGGTCACGTCTTCGAGGATGGTC
>probe:Drosophila_2:1635788_a_at:394:707; Interrogation_Position=676; Antisense; TTGAGTTCGTGAACGCGGATCCCGC
>probe:Drosophila_2:1635788_a_at:520:273; Interrogation_Position=740; Antisense; CATTGCCCAGCAGTGATGCCGAGGA
>probe:Drosophila_2:1635788_a_at:135:513; Interrogation_Position=752; Antisense; GTGATGCCGAGGATCAACCGCCAAA
>probe:Drosophila_2:1635788_a_at:729:203; Interrogation_Position=787; Antisense; AAGCCTCAGAGTGTCGTTGCTGTTA
>probe:Drosophila_2:1635788_a_at:551:515; Interrogation_Position=826; Antisense; GTGTACTTTCTAACTTTCCGCAAAT
>probe:Drosophila_2:1635788_a_at:149:523; Interrogation_Position=851; Antisense; GTGGCCAATTTTAGCTCGTAGTCAA
>probe:Drosophila_2:1635788_a_at:161:675; Interrogation_Position=862; Antisense; TAGCTCGTAGTCAAGTCAATCGCCC
>probe:Drosophila_2:1635788_a_at:203:235; Interrogation_Position=879; Antisense; AATCGCCCCTCTGTTTGTGTAAATA
>probe:Drosophila_2:1635788_a_at:700:25; Interrogation_Position=951; Antisense; ATACCGAATACTCTGTAACCCCACA

Paste this into a BLAST search page for me
TCGTGTGCCACCAGGATCTGTTCAGGATCTGTTCAGCTCGGAGACCAAGTGGATGGCCGGCCTTCAACGATGTCCAACGTATACGCACTGAGGTCCGCTGATGGGTCACGTCTTCGAGGATGGTCTTGAGTTCGTGAACGCGGATCCCGCCATTGCCCAGCAGTGATGCCGAGGAGTGATGCCGAGGATCAACCGCCAAAAAGCCTCAGAGTGTCGTTGCTGTTAGTGTACTTTCTAACTTTCCGCAAATGTGGCCAATTTTAGCTCGTAGTCAATAGCTCGTAGTCAAGTCAATCGCCCAATCGCCCCTCTGTTTGTGTAAATAATACCGAATACTCTGTAACCCCACA

Full Affymetrix probeset data:

Annotations for 1635788_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime