Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635789_at:

>probe:Drosophila_2:1635789_at:205:261; Interrogation_Position=5375; Antisense; CAGAGCTTCGTCATACTTGGTTAGT
>probe:Drosophila_2:1635789_at:667:229; Interrogation_Position=5425; Antisense; AATGGGAATCTGTCGGAGGCTGCCT
>probe:Drosophila_2:1635789_at:614:627; Interrogation_Position=5452; Antisense; TGCCATCTCCACATTGCTGCTTTAA
>probe:Drosophila_2:1635789_at:407:519; Interrogation_Position=5501; Antisense; GTGGTTGCACTCTTAGTTGGTCATC
>probe:Drosophila_2:1635789_at:446:467; Interrogation_Position=5516; Antisense; GTTGGTCATCCACTGCATTCGGAAA
>probe:Drosophila_2:1635789_at:268:79; Interrogation_Position=5571; Antisense; AGGTCTCAAACTGGATGCCGGTGCT
>probe:Drosophila_2:1635789_at:574:49; Interrogation_Position=5585; Antisense; ATGCCGGTGCTCAGGATTCCCAGTA
>probe:Drosophila_2:1635789_at:207:117; Interrogation_Position=5639; Antisense; AGCTATGTGCTGACTTCTTGGATCG
>probe:Drosophila_2:1635789_at:67:433; Interrogation_Position=5677; Antisense; GAGTGCCTTGGAGAGCTCTACAAAC
>probe:Drosophila_2:1635789_at:698:425; Interrogation_Position=5723; Antisense; GAGATCGTAGTTACCAGGACCTGGC
>probe:Drosophila_2:1635789_at:103:421; Interrogation_Position=5758; Antisense; GAGCATCTCACGCAAGCCTATAATA
>probe:Drosophila_2:1635789_at:667:453; Interrogation_Position=5809; Antisense; GATCATGCCATCGAGTTTGTGTACA
>probe:Drosophila_2:1635789_at:462:165; Interrogation_Position=5861; Antisense; AAATCTCTGAGCGACTTGCCAAACA
>probe:Drosophila_2:1635789_at:716:267; Interrogation_Position=5925; Antisense; CATGGACTCATCACCGGTATTTTTG

Paste this into a BLAST search page for me
CAGAGCTTCGTCATACTTGGTTAGTAATGGGAATCTGTCGGAGGCTGCCTTGCCATCTCCACATTGCTGCTTTAAGTGGTTGCACTCTTAGTTGGTCATCGTTGGTCATCCACTGCATTCGGAAAAGGTCTCAAACTGGATGCCGGTGCTATGCCGGTGCTCAGGATTCCCAGTAAGCTATGTGCTGACTTCTTGGATCGGAGTGCCTTGGAGAGCTCTACAAACGAGATCGTAGTTACCAGGACCTGGCGAGCATCTCACGCAAGCCTATAATAGATCATGCCATCGAGTTTGTGTACAAAATCTCTGAGCGACTTGCCAAACACATGGACTCATCACCGGTATTTTTG

Full Affymetrix probeset data:

Annotations for 1635789_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime