FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635791_at:

>probe:Drosophila_2:1635791_at:523:177; Interrogation_Position=221; Antisense; AAACTAACTTTACGGCTTGCATCTC
>probe:Drosophila_2:1635791_at:361:633; Interrogation_Position=242; Antisense; TCTCGGCCTATGACAATTGCACATC
>probe:Drosophila_2:1635791_at:254:5; Interrogation_Position=257; Antisense; ATTGCACATCCCATATCAGCGAGAA
>probe:Drosophila_2:1635791_at:54:375; Interrogation_Position=279; Antisense; GAAGTATGCCGAGGATCGCCAGATC
>probe:Drosophila_2:1635791_at:89:315; Interrogation_Position=350; Antisense; GCCAGGTCTGGACTCTTGAGCAGCA
>probe:Drosophila_2:1635791_at:459:101; Interrogation_Position=428; Antisense; AGAGCTCCAAGACCTTCTATGCCAT
>probe:Drosophila_2:1635791_at:254:235; Interrogation_Position=460; Antisense; AATGCCACGCAGATTGCAGTTCAGA
>probe:Drosophila_2:1635791_at:611:415; Interrogation_Position=510; Antisense; GAGCCGGAAGAGTGTTTGCATCAAT
>probe:Drosophila_2:1635791_at:59:233; Interrogation_Position=532; Antisense; AATGACGCAAATCGCTCCTATGTGG
>probe:Drosophila_2:1635791_at:42:65; Interrogation_Position=551; Antisense; ATGTGGAAGACACCTCCGATACCTA
>probe:Drosophila_2:1635791_at:184:455; Interrogation_Position=568; Antisense; GATACCTACGAGCTTTTGAACAACT
>probe:Drosophila_2:1635791_at:651:385; Interrogation_Position=585; Antisense; GAACAACTGCCTCAAGAACGGACCA
>probe:Drosophila_2:1635791_at:261:493; Interrogation_Position=623; Antisense; GTAATCCATTGACTTACCCTACAAC
>probe:Drosophila_2:1635791_at:568:235; Interrogation_Position=675; Antisense; AATAACAACCGCAGCACCTTTACTT

Paste this into a BLAST search page for me
AAACTAACTTTACGGCTTGCATCTCTCTCGGCCTATGACAATTGCACATCATTGCACATCCCATATCAGCGAGAAGAAGTATGCCGAGGATCGCCAGATCGCCAGGTCTGGACTCTTGAGCAGCAAGAGCTCCAAGACCTTCTATGCCATAATGCCACGCAGATTGCAGTTCAGAGAGCCGGAAGAGTGTTTGCATCAATAATGACGCAAATCGCTCCTATGTGGATGTGGAAGACACCTCCGATACCTAGATACCTACGAGCTTTTGAACAACTGAACAACTGCCTCAAGAACGGACCAGTAATCCATTGACTTACCCTACAACAATAACAACCGCAGCACCTTTACTT

Full Affymetrix probeset data:

Annotations for 1635791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720