Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635792_a_at:

>probe:Drosophila_2:1635792_a_at:670:287; Interrogation_Position=1024; Antisense; CTGGCCGACATCATGGGTGGACCTC
>probe:Drosophila_2:1635792_a_at:456:431; Interrogation_Position=1096; Antisense; GAGTCGTAGTCATAACTTCGCTGCT
>probe:Drosophila_2:1635792_a_at:662:599; Interrogation_Position=1142; Antisense; TGTCTTTGCCTATCATCCTGTGTGT
>probe:Drosophila_2:1635792_a_at:248:631; Interrogation_Position=1157; Antisense; TCCTGTGTGTCCCTGCGAAATAAAC
>probe:Drosophila_2:1635792_a_at:261:525; Interrogation_Position=616; Antisense; GGGAACTGGTGCCTATCCTGGCTAT
>probe:Drosophila_2:1635792_a_at:308:671; Interrogation_Position=644; Antisense; TACCCCGGAGTATACTTGCCACAGT
>probe:Drosophila_2:1635792_a_at:387:417; Interrogation_Position=720; Antisense; GAGCTGTGGCTCAACCAGGAGTTCC
>probe:Drosophila_2:1635792_a_at:222:429; Interrogation_Position=738; Antisense; GAGTTCCTGGAGTAGCTGGAGTTCC
>probe:Drosophila_2:1635792_a_at:462:55; Interrogation_Position=824; Antisense; ATGAACTATCATCGCTATCCGGCTC
>probe:Drosophila_2:1635792_a_at:296:449; Interrogation_Position=860; Antisense; GATCCGAGCCATTGGGACCATCATT
>probe:Drosophila_2:1635792_a_at:338:413; Interrogation_Position=875; Antisense; GACCATCATTTCTCGATGAACACCG
>probe:Drosophila_2:1635792_a_at:196:535; Interrogation_Position=910; Antisense; GGATGGCGTCCACAAGGGACCATTT
>probe:Drosophila_2:1635792_a_at:415:387; Interrogation_Position=943; Antisense; GAACAATCACAATGCCTTTGGCTAT
>probe:Drosophila_2:1635792_a_at:6:523; Interrogation_Position=982; Antisense; GGGCGGATACAACGGTGCCTTCAAC

Paste this into a BLAST search page for me
CTGGCCGACATCATGGGTGGACCTCGAGTCGTAGTCATAACTTCGCTGCTTGTCTTTGCCTATCATCCTGTGTGTTCCTGTGTGTCCCTGCGAAATAAACGGGAACTGGTGCCTATCCTGGCTATTACCCCGGAGTATACTTGCCACAGTGAGCTGTGGCTCAACCAGGAGTTCCGAGTTCCTGGAGTAGCTGGAGTTCCATGAACTATCATCGCTATCCGGCTCGATCCGAGCCATTGGGACCATCATTGACCATCATTTCTCGATGAACACCGGGATGGCGTCCACAAGGGACCATTTGAACAATCACAATGCCTTTGGCTATGGGCGGATACAACGGTGCCTTCAAC

Full Affymetrix probeset data:

Annotations for 1635792_a_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime