FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635793_at:

>probe:Drosophila_2:1635793_at:273:389; Interrogation_Position=107; Antisense; GAAAACCAAGCCAGCGCTGCCGGAT
>probe:Drosophila_2:1635793_at:121:547; Interrogation_Position=128; Antisense; GGATCCCAGCCAGTTGCTAGCCAAG
>probe:Drosophila_2:1635793_at:188:311; Interrogation_Position=158; Antisense; GCCAAAGCCGGACTTTCTCAAGGAT
>probe:Drosophila_2:1635793_at:711:77; Interrogation_Position=178; Antisense; AGGATCCCTCTAAATTACTAGCCAA
>probe:Drosophila_2:1635793_at:470:183; Interrogation_Position=201; Antisense; AAAATCGCGCAATCCAAACCAGCTC
>probe:Drosophila_2:1635793_at:138:589; Interrogation_Position=25; Antisense; TGGATCTTCTCAAGAGGCACCTGCT
>probe:Drosophila_2:1635793_at:253:263; Interrogation_Position=291; Antisense; CAGCTGCTCTCCAAGTTCGTGAAAC
>probe:Drosophila_2:1635793_at:201:471; Interrogation_Position=305; Antisense; GTTCGTGAAACCAAAGCCAGTGATC
>probe:Drosophila_2:1635793_at:675:313; Interrogation_Position=320; Antisense; GCCAGTGATCATAAAGCCGGTGATT
>probe:Drosophila_2:1635793_at:151:591; Interrogation_Position=395; Antisense; TGGTCACGGCCACGGACATCATGGA
>probe:Drosophila_2:1635793_at:299:559; Interrogation_Position=426; Antisense; GGACACCATGGCAAGGGCAAGCTAT
>probe:Drosophila_2:1635793_at:441:397; Interrogation_Position=529; Antisense; GACAAGTTCATCACTCGGCTTTAAA
>probe:Drosophila_2:1635793_at:532:645; Interrogation_Position=58; Antisense; TCATCGGAGCTTGCCTGTGTGTCTG
>probe:Drosophila_2:1635793_at:478:69; Interrogation_Position=88; Antisense; AGGCCACGATCACCATCCAGAAAAC

Paste this into a BLAST search page for me
GAAAACCAAGCCAGCGCTGCCGGATGGATCCCAGCCAGTTGCTAGCCAAGGCCAAAGCCGGACTTTCTCAAGGATAGGATCCCTCTAAATTACTAGCCAAAAAATCGCGCAATCCAAACCAGCTCTGGATCTTCTCAAGAGGCACCTGCTCAGCTGCTCTCCAAGTTCGTGAAACGTTCGTGAAACCAAAGCCAGTGATCGCCAGTGATCATAAAGCCGGTGATTTGGTCACGGCCACGGACATCATGGAGGACACCATGGCAAGGGCAAGCTATGACAAGTTCATCACTCGGCTTTAAATCATCGGAGCTTGCCTGTGTGTCTGAGGCCACGATCACCATCCAGAAAAC

Full Affymetrix probeset data:

Annotations for 1635793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720