Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635794_a_at:

>probe:Drosophila_2:1635794_a_at:267:3; Interrogation_Position=125; Antisense; ATTGGAACCAGCTTAAACCCGTGCT
>probe:Drosophila_2:1635794_a_at:65:501; Interrogation_Position=172; Antisense; GTCGAATCATTTCCCATTGTCTTTT
>probe:Drosophila_2:1635794_a_at:142:509; Interrogation_Position=205; Antisense; GTGCTGCTCAGTGTCTTTGGAACAT
>probe:Drosophila_2:1635794_a_at:659:217; Interrogation_Position=254; Antisense; AAGTTTGGTCATGTCCCTGCACCAA
>probe:Drosophila_2:1635794_a_at:717:253; Interrogation_Position=295; Antisense; CAACGGCACTTCTATGTCCTAAAAC
>probe:Drosophila_2:1635794_a_at:119:729; Interrogation_Position=321; Antisense; TTGGACGCTGCGAAAGGCTCGACTT
>probe:Drosophila_2:1635794_a_at:41:727; Interrogation_Position=346; Antisense; TTGAGCTTGGCCATAATCCTGATCG
>probe:Drosophila_2:1635794_a_at:324:47; Interrogation_Position=361; Antisense; ATCCTGATCGCTTGGCTAATGCTTA
>probe:Drosophila_2:1635794_a_at:542:61; Interrogation_Position=418; Antisense; ATGTCGCCATGGATTCTGGTGACCA
>probe:Drosophila_2:1635794_a_at:601:591; Interrogation_Position=434; Antisense; TGGTGACCAGCATCGTCCTAACGAT
>probe:Drosophila_2:1635794_a_at:601:195; Interrogation_Position=453; Antisense; AACGATGGAGTGCTTCCTTTGGTCC
>probe:Drosophila_2:1635794_a_at:142:477; Interrogation_Position=532; Antisense; GTTTTGCATGTGATCTTCGTCGCGA
>probe:Drosophila_2:1635794_a_at:384:639; Interrogation_Position=548; Antisense; TCGTCGCGATGGTTTGCTGCGTGAA
>probe:Drosophila_2:1635794_a_at:275:295; Interrogation_Position=606; Antisense; CGAGCACTCGCTGCGTATCATTTGA

Paste this into a BLAST search page for me
ATTGGAACCAGCTTAAACCCGTGCTGTCGAATCATTTCCCATTGTCTTTTGTGCTGCTCAGTGTCTTTGGAACATAAGTTTGGTCATGTCCCTGCACCAACAACGGCACTTCTATGTCCTAAAACTTGGACGCTGCGAAAGGCTCGACTTTTGAGCTTGGCCATAATCCTGATCGATCCTGATCGCTTGGCTAATGCTTAATGTCGCCATGGATTCTGGTGACCATGGTGACCAGCATCGTCCTAACGATAACGATGGAGTGCTTCCTTTGGTCCGTTTTGCATGTGATCTTCGTCGCGATCGTCGCGATGGTTTGCTGCGTGAACGAGCACTCGCTGCGTATCATTTGA

Full Affymetrix probeset data:

Annotations for 1635794_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime