Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635797_at:

>probe:Drosophila_2:1635797_at:566:423; Interrogation_Position=2746; Antisense; GAGAAATTCTTCGATCGCCTGGGAC
>probe:Drosophila_2:1635797_at:363:591; Interrogation_Position=2765; Antisense; TGGGACTGAACGACGAGGCCTTCCA
>probe:Drosophila_2:1635797_at:558:137; Interrogation_Position=2789; Antisense; ACGAGATCTACAGCCAACCGAGGAG
>probe:Drosophila_2:1635797_at:110:317; Interrogation_Position=2836; Antisense; GCCTCCGATGATTCCAGCACTGTTT
>probe:Drosophila_2:1635797_at:357:113; Interrogation_Position=2851; Antisense; AGCACTGTTTTCTTCTCGGACGTAA
>probe:Drosophila_2:1635797_at:496:659; Interrogation_Position=2873; Antisense; TAAGCACCGTGGACTCGATGCGATT
>probe:Drosophila_2:1635797_at:475:51; Interrogation_Position=2890; Antisense; ATGCGATTGCCGGACAGCACGGAAA
>probe:Drosophila_2:1635797_at:193:259; Interrogation_Position=2928; Antisense; CACTCAGGCGTATAGACCCTCGGAA
>probe:Drosophila_2:1635797_at:560:201; Interrogation_Position=2951; Antisense; AACCGCCGTCGATTGTCGAGCGGAA
>probe:Drosophila_2:1635797_at:389:501; Interrogation_Position=2965; Antisense; GTCGAGCGGAATGCCAGGATCATCA
>probe:Drosophila_2:1635797_at:709:53; Interrogation_Position=3013; Antisense; ATGCAGTGCACCTGAGAATCGCCGG
>probe:Drosophila_2:1635797_at:498:555; Interrogation_Position=3070; Antisense; GGACGCTAAGTGCTCCACTGATTTA
>probe:Drosophila_2:1635797_at:150:461; Interrogation_Position=3089; Antisense; GATTTATAGATTCCACACGACCACC
>probe:Drosophila_2:1635797_at:137:303; Interrogation_Position=3113; Antisense; CCCGTTTAGCACACGACTGCGAATT

Paste this into a BLAST search page for me
GAGAAATTCTTCGATCGCCTGGGACTGGGACTGAACGACGAGGCCTTCCAACGAGATCTACAGCCAACCGAGGAGGCCTCCGATGATTCCAGCACTGTTTAGCACTGTTTTCTTCTCGGACGTAATAAGCACCGTGGACTCGATGCGATTATGCGATTGCCGGACAGCACGGAAACACTCAGGCGTATAGACCCTCGGAAAACCGCCGTCGATTGTCGAGCGGAAGTCGAGCGGAATGCCAGGATCATCAATGCAGTGCACCTGAGAATCGCCGGGGACGCTAAGTGCTCCACTGATTTAGATTTATAGATTCCACACGACCACCCCCGTTTAGCACACGACTGCGAATT

Full Affymetrix probeset data:

Annotations for 1635797_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime