FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635799_at:

>probe:Drosophila_2:1635799_at:280:149; Interrogation_Position=1030; Antisense; ACATATTTCGTAGCGTAGCCCTTAA
>probe:Drosophila_2:1635799_at:204:373; Interrogation_Position=1076; Antisense; GAAGTTCTGGCGTCAGTCAGCGGTA
>probe:Drosophila_2:1635799_at:187:271; Interrogation_Position=1178; Antisense; CATCTACCTTTATTTTTGACCCACA
>probe:Drosophila_2:1635799_at:72:303; Interrogation_Position=637; Antisense; CCCCAGGTGGTCATACAGTTCTATG
>probe:Drosophila_2:1635799_at:475:93; Interrogation_Position=653; Antisense; AGTTCTATGAGGAGCGCCTCACCTG
>probe:Drosophila_2:1635799_at:435:1; Interrogation_Position=707; Antisense; ATACGAATTCCGTCAATTTGGGATC
>probe:Drosophila_2:1635799_at:70:245; Interrogation_Position=721; Antisense; AATTTGGGATCATCCGGTGGCCTGG
>probe:Drosophila_2:1635799_at:455:443; Interrogation_Position=772; Antisense; GATGATACTGCTCCCGGCAGCGTTG
>probe:Drosophila_2:1635799_at:62:261; Interrogation_Position=801; Antisense; CACCGGTGGCGGCAGCAATATAGAT
>probe:Drosophila_2:1635799_at:461:583; Interrogation_Position=864; Antisense; TGGCAGCATCAATCAAGACGAGAAT
>probe:Drosophila_2:1635799_at:321:197; Interrogation_Position=919; Antisense; AACGGACAGCCGGATGCGGATGACT
>probe:Drosophila_2:1635799_at:445:99; Interrogation_Position=961; Antisense; AGATGACTGTTTCGGATTCACTCGC
>probe:Drosophila_2:1635799_at:276:543; Interrogation_Position=974; Antisense; GGATTCACTCGCTTATGTGGATACA
>probe:Drosophila_2:1635799_at:520:517; Interrogation_Position=990; Antisense; GTGGATACATACACACCGGCTTTAT

Paste this into a BLAST search page for me
ACATATTTCGTAGCGTAGCCCTTAAGAAGTTCTGGCGTCAGTCAGCGGTACATCTACCTTTATTTTTGACCCACACCCCAGGTGGTCATACAGTTCTATGAGTTCTATGAGGAGCGCCTCACCTGATACGAATTCCGTCAATTTGGGATCAATTTGGGATCATCCGGTGGCCTGGGATGATACTGCTCCCGGCAGCGTTGCACCGGTGGCGGCAGCAATATAGATTGGCAGCATCAATCAAGACGAGAATAACGGACAGCCGGATGCGGATGACTAGATGACTGTTTCGGATTCACTCGCGGATTCACTCGCTTATGTGGATACAGTGGATACATACACACCGGCTTTAT

Full Affymetrix probeset data:

Annotations for 1635799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720