FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635801_at:

>probe:Drosophila_2:1635801_at:166:121; Interrogation_Position=113; Antisense; AGCTGTGCTGCCATTGTGGTGATGC
>probe:Drosophila_2:1635801_at:623:533; Interrogation_Position=130; Antisense; GGTGATGCTGTGTCTGTTCGCCAGA
>probe:Drosophila_2:1635801_at:123:97; Interrogation_Position=152; Antisense; AGATTTGCTCCTTGTGATTTCACCG
>probe:Drosophila_2:1635801_at:594:17; Interrogation_Position=168; Antisense; ATTTCACCGGATGCTGGATCTTCGT
>probe:Drosophila_2:1635801_at:431:545; Interrogation_Position=183; Antisense; GGATCTTCGTTTTCGTGTTATCTCT
>probe:Drosophila_2:1635801_at:223:563; Interrogation_Position=224; Antisense; GGAATAGTGGCCATTTTCTTCCCAA
>probe:Drosophila_2:1635801_at:155:15; Interrogation_Position=236; Antisense; ATTTTCTTCCCAACCATACGTATAG
>probe:Drosophila_2:1635801_at:258:27; Interrogation_Position=251; Antisense; ATACGTATAGTGTACGCCTCGCTGG
>probe:Drosophila_2:1635801_at:292:433; Interrogation_Position=276; Antisense; GAGTGCTCCTATTCTGTGTGTATAT
>probe:Drosophila_2:1635801_at:40:321; Interrogation_Position=28; Antisense; GCCCATGTATTTTGAGGACCGGTAT
>probe:Drosophila_2:1635801_at:292:481; Interrogation_Position=368; Antisense; GTATTGGCTGCCATGTCACTATACA
>probe:Drosophila_2:1635801_at:554:481; Interrogation_Position=401; Antisense; GTATTCCTCTTCCTGTATTTACTAG
>probe:Drosophila_2:1635801_at:223:499; Interrogation_Position=57; Antisense; GTCGGATCTTCATCAGTCGGGTATT
>probe:Drosophila_2:1635801_at:253:679; Interrogation_Position=87; Antisense; TAGTGGCCGTTTTTATAGCCGTGGC

Paste this into a BLAST search page for me
AGCTGTGCTGCCATTGTGGTGATGCGGTGATGCTGTGTCTGTTCGCCAGAAGATTTGCTCCTTGTGATTTCACCGATTTCACCGGATGCTGGATCTTCGTGGATCTTCGTTTTCGTGTTATCTCTGGAATAGTGGCCATTTTCTTCCCAAATTTTCTTCCCAACCATACGTATAGATACGTATAGTGTACGCCTCGCTGGGAGTGCTCCTATTCTGTGTGTATATGCCCATGTATTTTGAGGACCGGTATGTATTGGCTGCCATGTCACTATACAGTATTCCTCTTCCTGTATTTACTAGGTCGGATCTTCATCAGTCGGGTATTTAGTGGCCGTTTTTATAGCCGTGGC

Full Affymetrix probeset data:

Annotations for 1635801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720