FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635804_at:

>probe:Drosophila_2:1635804_at:598:397; Interrogation_Position=2619; Antisense; GACAAACTGTAGTTCCGCAGCTAGT
>probe:Drosophila_2:1635804_at:323:353; Interrogation_Position=2635; Antisense; GCAGCTAGTCGTTGGATCGCACTTT
>probe:Drosophila_2:1635804_at:174:263; Interrogation_Position=2663; Antisense; CAGCGATCCGCGGTTAAACTTGCAG
>probe:Drosophila_2:1635804_at:58:475; Interrogation_Position=2675; Antisense; GTTAAACTTGCAGATGGACTCCAGA
>probe:Drosophila_2:1635804_at:371:347; Interrogation_Position=2739; Antisense; GCATCCTCAGACAGCATGTTCGGTG
>probe:Drosophila_2:1635804_at:8:89; Interrogation_Position=2792; Antisense; AGTCGTCGACGGCAATTCCTGCTGA
>probe:Drosophila_2:1635804_at:329:719; Interrogation_Position=2807; Antisense; TTCCTGCTGATATATGCTGCCCAAG
>probe:Drosophila_2:1635804_at:335:43; Interrogation_Position=2820; Antisense; ATGCTGCCCAAGTGTGGCCCCGGAG
>probe:Drosophila_2:1635804_at:696:543; Interrogation_Position=2923; Antisense; TTGAAGGAGTCGGTCCCACATAACT
>probe:Drosophila_2:1635804_at:313:203; Interrogation_Position=2952; Antisense; AACCACCGTGGTGCTTGAGGAAGCT
>probe:Drosophila_2:1635804_at:193:205; Interrogation_Position=2997; Antisense; AAGCGACAAGCGTCCATTGTTTGTT
>probe:Drosophila_2:1635804_at:20:385; Interrogation_Position=3028; Antisense; GAACTTTGCTGCTTTAGCTTCGACT
>probe:Drosophila_2:1635804_at:608:675; Interrogation_Position=3042; Antisense; TAGCTTCGACTGTTTGTGCTCTAGT
>probe:Drosophila_2:1635804_at:582:479; Interrogation_Position=3053; Antisense; GTTTGTGCTCTAGTTTCTATACGTA

Paste this into a BLAST search page for me
GACAAACTGTAGTTCCGCAGCTAGTGCAGCTAGTCGTTGGATCGCACTTTCAGCGATCCGCGGTTAAACTTGCAGGTTAAACTTGCAGATGGACTCCAGAGCATCCTCAGACAGCATGTTCGGTGAGTCGTCGACGGCAATTCCTGCTGATTCCTGCTGATATATGCTGCCCAAGATGCTGCCCAAGTGTGGCCCCGGAGTTGAAGGAGTCGGTCCCACATAACTAACCACCGTGGTGCTTGAGGAAGCTAAGCGACAAGCGTCCATTGTTTGTTGAACTTTGCTGCTTTAGCTTCGACTTAGCTTCGACTGTTTGTGCTCTAGTGTTTGTGCTCTAGTTTCTATACGTA

Full Affymetrix probeset data:

Annotations for 1635804_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720