Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635805_at:

>probe:Drosophila_2:1635805_at:186:219; Interrogation_Position=1129; Antisense; AAGTGACCTGCTTGATGTGGAGTCT
>probe:Drosophila_2:1635805_at:410:63; Interrogation_Position=1143; Antisense; ATGTGGAGTCTAATCCCTGCAAGCC
>probe:Drosophila_2:1635805_at:426:541; Interrogation_Position=1187; Antisense; GGATTGCCCTTAAATCTGTTTCGTT
>probe:Drosophila_2:1635805_at:324:283; Interrogation_Position=1202; Antisense; CTGTTTCGTTGCGACTTTCGAGACC
>probe:Drosophila_2:1635805_at:358:515; Interrogation_Position=1239; Antisense; GTGTAAACCATCCAAGCAGCGGTGA
>probe:Drosophila_2:1635805_at:406:211; Interrogation_Position=1272; Antisense; AAGAAGCCATGGATACAGCCGCCGA
>probe:Drosophila_2:1635805_at:72:125; Interrogation_Position=1288; Antisense; AGCCGCCGACGAATCAAATGACTTA
>probe:Drosophila_2:1635805_at:46:633; Interrogation_Position=1318; Antisense; TCCGGAGCACTTGGAGCGTGATCTT
>probe:Drosophila_2:1635805_at:712:417; Interrogation_Position=1331; Antisense; GAGCGTGATCTTACAGCGTGGATTT
>probe:Drosophila_2:1635805_at:291:187; Interrogation_Position=1388; Antisense; AACACCCAGTGTGAGTGGACGCAAT
>probe:Drosophila_2:1635805_at:595:223; Interrogation_Position=1493; Antisense; AAGGTACTGGCTCAGGTAATCCTGT
>probe:Drosophila_2:1635805_at:312:493; Interrogation_Position=1508; Antisense; GTAATCCTGTTGCAAGATTCCGTCA
>probe:Drosophila_2:1635805_at:636:215; Interrogation_Position=1521; Antisense; AAGATTCCGTCAATCCGCGTCAATA
>probe:Drosophila_2:1635805_at:243:299; Interrogation_Position=1536; Antisense; CGCGTCAATATCAGCCTCTTTTAGA

Paste this into a BLAST search page for me
AAGTGACCTGCTTGATGTGGAGTCTATGTGGAGTCTAATCCCTGCAAGCCGGATTGCCCTTAAATCTGTTTCGTTCTGTTTCGTTGCGACTTTCGAGACCGTGTAAACCATCCAAGCAGCGGTGAAAGAAGCCATGGATACAGCCGCCGAAGCCGCCGACGAATCAAATGACTTATCCGGAGCACTTGGAGCGTGATCTTGAGCGTGATCTTACAGCGTGGATTTAACACCCAGTGTGAGTGGACGCAATAAGGTACTGGCTCAGGTAATCCTGTGTAATCCTGTTGCAAGATTCCGTCAAAGATTCCGTCAATCCGCGTCAATACGCGTCAATATCAGCCTCTTTTAGA

Full Affymetrix probeset data:

Annotations for 1635805_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime