FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635806_at:

>probe:Drosophila_2:1635806_at:535:399; Interrogation_Position=100; Antisense; GACAGGACCATCTACTACCGGAATA
>probe:Drosophila_2:1635806_at:282:537; Interrogation_Position=142; Antisense; GGTCACTACAGCTTCGAGTTCCAGA
>probe:Drosophila_2:1635806_at:553:427; Interrogation_Position=157; Antisense; GAGTTCCAGACCACCAACGGCATTA
>probe:Drosophila_2:1635806_at:52:197; Interrogation_Position=172; Antisense; AACGGCATTACCACCAAGGGAGCTG
>probe:Drosophila_2:1635806_at:270:125; Interrogation_Position=210; Antisense; AGCCGTCGGAGTGGTTCAGTTCGTT
>probe:Drosophila_2:1635806_at:414:635; Interrogation_Position=225; Antisense; TCAGTTCGTTTCTCCCGAGGGTATA
>probe:Drosophila_2:1635806_at:139:637; Interrogation_Position=262; Antisense; TCGTACGTGGCCGATGCCAATGGAT
>probe:Drosophila_2:1635806_at:110:251; Interrogation_Position=279; Antisense; CAATGGATATCAGCCCACCGGAGAT
>probe:Drosophila_2:1635806_at:476:3; Interrogation_Position=31; Antisense; ATTGTGGTATTCCTGGTCCTAGTCC
>probe:Drosophila_2:1635806_at:72:261; Interrogation_Position=325; Antisense; CACGTTATCCGCCAGTTGGAGTACA
>probe:Drosophila_2:1635806_at:508:55; Interrogation_Position=371; Antisense; ATGAGATTCGGTCCAGACGTTGGTA
>probe:Drosophila_2:1635806_at:682:535; Interrogation_Position=45; Antisense; GGTCCTAGTCCTAGTTCAACTAATC
>probe:Drosophila_2:1635806_at:622:653; Interrogation_Position=65; Antisense; TAATCCATTGTACGCGCTTTACTGC
>probe:Drosophila_2:1635806_at:29:699; Interrogation_Position=82; Antisense; TTTACTGCGCCATCTTTGGACAGGA

Paste this into a BLAST search page for me
GACAGGACCATCTACTACCGGAATAGGTCACTACAGCTTCGAGTTCCAGAGAGTTCCAGACCACCAACGGCATTAAACGGCATTACCACCAAGGGAGCTGAGCCGTCGGAGTGGTTCAGTTCGTTTCAGTTCGTTTCTCCCGAGGGTATATCGTACGTGGCCGATGCCAATGGATCAATGGATATCAGCCCACCGGAGATATTGTGGTATTCCTGGTCCTAGTCCCACGTTATCCGCCAGTTGGAGTACAATGAGATTCGGTCCAGACGTTGGTAGGTCCTAGTCCTAGTTCAACTAATCTAATCCATTGTACGCGCTTTACTGCTTTACTGCGCCATCTTTGGACAGGA

Full Affymetrix probeset data:

Annotations for 1635806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720