Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635807_at:

>probe:Drosophila_2:1635807_at:616:405; Interrogation_Position=2260; Antisense; GACTGGGTTTCCCACAGTTGCAACG
>probe:Drosophila_2:1635807_at:121:623; Interrogation_Position=2290; Antisense; TGCGGCGATGGCTTCCAATTGCGAA
>probe:Drosophila_2:1635807_at:703:533; Interrogation_Position=2322; Antisense; GGTGCTCCGTACTCCGAAGTATGGA
>probe:Drosophila_2:1635807_at:406:65; Interrogation_Position=2342; Antisense; ATGGAGGCAAGCCATGTCCCAAGCA
>probe:Drosophila_2:1635807_at:312:129; Interrogation_Position=2366; Antisense; ACCTGGTACGTTTGGATCGCTGCTA
>probe:Drosophila_2:1635807_at:155:341; Interrogation_Position=2387; Antisense; GCTACCAGCGGTGCGATGACATGTA
>probe:Drosophila_2:1635807_at:332:593; Interrogation_Position=2448; Antisense; TGTGGTAAGAGCTCCGCAACCGGAA
>probe:Drosophila_2:1635807_at:266:381; Interrogation_Position=2470; Antisense; GAACCGCAGGACGAGTGTCGCTACT
>probe:Drosophila_2:1635807_at:463:229; Interrogation_Position=2568; Antisense; AATGAACACCGATCTGAGCTACAAG
>probe:Drosophila_2:1635807_at:439:615; Interrogation_Position=2593; Antisense; TGCAAGGATCGCGTCCGCATGGAAA
>probe:Drosophila_2:1635807_at:709:219; Interrogation_Position=2617; Antisense; AAGTGCGTGATGATGCCTTGCCAGC
>probe:Drosophila_2:1635807_at:425:161; Interrogation_Position=2753; Antisense; AAATTCCAGACTACCTACACTAGCT
>probe:Drosophila_2:1635807_at:507:147; Interrogation_Position=2771; Antisense; ACTAGCTCTTCTCGCAACAGATTAA
>probe:Drosophila_2:1635807_at:135:245; Interrogation_Position=2821; Antisense; AATTGTGTTCGCGTGGTAATTCCAA

Paste this into a BLAST search page for me
GACTGGGTTTCCCACAGTTGCAACGTGCGGCGATGGCTTCCAATTGCGAAGGTGCTCCGTACTCCGAAGTATGGAATGGAGGCAAGCCATGTCCCAAGCAACCTGGTACGTTTGGATCGCTGCTAGCTACCAGCGGTGCGATGACATGTATGTGGTAAGAGCTCCGCAACCGGAAGAACCGCAGGACGAGTGTCGCTACTAATGAACACCGATCTGAGCTACAAGTGCAAGGATCGCGTCCGCATGGAAAAAGTGCGTGATGATGCCTTGCCAGCAAATTCCAGACTACCTACACTAGCTACTAGCTCTTCTCGCAACAGATTAAAATTGTGTTCGCGTGGTAATTCCAA

Full Affymetrix probeset data:

Annotations for 1635807_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime