FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635809_at:

>probe:Drosophila_2:1635809_at:436:281; Interrogation_Position=1033; Antisense; CTGCGGTCACGATCAGGACTGTTTA
>probe:Drosophila_2:1635809_at:527:689; Interrogation_Position=1159; Antisense; TTTGGAGCACTATATACCCCGTTAT
>probe:Drosophila_2:1635809_at:516:671; Interrogation_Position=1173; Antisense; TACCCCGTTATTTCGCTAGAGCTAA
>probe:Drosophila_2:1635809_at:401:89; Interrogation_Position=1221; Antisense; AGTCTCTACAGAATCGCAATCGCAA
>probe:Drosophila_2:1635809_at:645:391; Interrogation_Position=1251; Antisense; GAAAGCCTCACGTTGATGCAGATGT
>probe:Drosophila_2:1635809_at:504:445; Interrogation_Position=1265; Antisense; GATGCAGATGTCAGGGCCATGGTCA
>probe:Drosophila_2:1635809_at:439:591; Interrogation_Position=1284; Antisense; TGGTCAGGCGGAATTTCACCCATGA
>probe:Drosophila_2:1635809_at:669:667; Interrogation_Position=1319; Antisense; TACTACTTCTGCAAACAGCGTCTTT
>probe:Drosophila_2:1635809_at:161:509; Interrogation_Position=813; Antisense; GTGACCCCGTGGAGCGCATGATAAG
>probe:Drosophila_2:1635809_at:25:539; Interrogation_Position=840; Antisense; GGTATTACTACGTCAGGAACTCCTA
>probe:Drosophila_2:1635809_at:577:561; Interrogation_Position=855; Antisense; GGAACTCCTATCGAAATGCCATATT
>probe:Drosophila_2:1635809_at:355:123; Interrogation_Position=909; Antisense; AGCCCACGGCCTGGTTCAAAAAGAG
>probe:Drosophila_2:1635809_at:725:531; Interrogation_Position=956; Antisense; GGTGACCCCGAGTGCCAGTATGTTC
>probe:Drosophila_2:1635809_at:339:483; Interrogation_Position=973; Antisense; GTATGTTCCATTGGCAGTTCGCGAT

Paste this into a BLAST search page for me
CTGCGGTCACGATCAGGACTGTTTATTTGGAGCACTATATACCCCGTTATTACCCCGTTATTTCGCTAGAGCTAAAGTCTCTACAGAATCGCAATCGCAAGAAAGCCTCACGTTGATGCAGATGTGATGCAGATGTCAGGGCCATGGTCATGGTCAGGCGGAATTTCACCCATGATACTACTTCTGCAAACAGCGTCTTTGTGACCCCGTGGAGCGCATGATAAGGGTATTACTACGTCAGGAACTCCTAGGAACTCCTATCGAAATGCCATATTAGCCCACGGCCTGGTTCAAAAAGAGGGTGACCCCGAGTGCCAGTATGTTCGTATGTTCCATTGGCAGTTCGCGAT

Full Affymetrix probeset data:

Annotations for 1635809_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720