FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635810_at:

>probe:Drosophila_2:1635810_at:360:675; Interrogation_Position=4382; Antisense; TAGACGACGAATCTGATCTGAGCAT
>probe:Drosophila_2:1635810_at:58:453; Interrogation_Position=4396; Antisense; GATCTGAGCATACAGCAGGCCTTAA
>probe:Drosophila_2:1635810_at:564:13; Interrogation_Position=4428; Antisense; ATTCAAGAGTTGCACGCTCCTGTTC
>probe:Drosophila_2:1635810_at:400:473; Interrogation_Position=4449; Antisense; GTTCATCGCACATCGCCTGCGAGGA
>probe:Drosophila_2:1635810_at:62:73; Interrogation_Position=4470; Antisense; AGGACTGCACGCCATGGATCGTATA
>probe:Drosophila_2:1635810_at:528:433; Interrogation_Position=4522; Antisense; GAGGAAGGCAATCCCCAAAGCCTGG
>probe:Drosophila_2:1635810_at:136:579; Interrogation_Position=4544; Antisense; TGGCCTCCGATAGCTCAACTATTTT
>probe:Drosophila_2:1635810_at:197:115; Interrogation_Position=4555; Antisense; AGCTCAACTATTTTCTACGGCATGC
>probe:Drosophila_2:1635810_at:1:697; Interrogation_Position=4566; Antisense; TTTCTACGGCATGCTATTGGCGCAG
>probe:Drosophila_2:1635810_at:33:691; Interrogation_Position=4580; Antisense; TATTGGCGCAGGACATTGATCCAGG
>probe:Drosophila_2:1635810_at:24:699; Interrogation_Position=4704; Antisense; TTTATCATACTTGTGTTCCTAACTA
>probe:Drosophila_2:1635810_at:593:183; Interrogation_Position=4728; Antisense; AACAATTCCATTTTGAGTCACATTC
>probe:Drosophila_2:1635810_at:487:427; Interrogation_Position=4771; Antisense; GAGATCTAGCATCACTTCGCAATTT
>probe:Drosophila_2:1635810_at:604:613; Interrogation_Position=4862; Antisense; TGAATCCGTTCAATGTGTACAAAAA

Paste this into a BLAST search page for me
TAGACGACGAATCTGATCTGAGCATGATCTGAGCATACAGCAGGCCTTAAATTCAAGAGTTGCACGCTCCTGTTCGTTCATCGCACATCGCCTGCGAGGAAGGACTGCACGCCATGGATCGTATAGAGGAAGGCAATCCCCAAAGCCTGGTGGCCTCCGATAGCTCAACTATTTTAGCTCAACTATTTTCTACGGCATGCTTTCTACGGCATGCTATTGGCGCAGTATTGGCGCAGGACATTGATCCAGGTTTATCATACTTGTGTTCCTAACTAAACAATTCCATTTTGAGTCACATTCGAGATCTAGCATCACTTCGCAATTTTGAATCCGTTCAATGTGTACAAAAA

Full Affymetrix probeset data:

Annotations for 1635810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720