FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635811_at:

>probe:Drosophila_2:1635811_at:552:17; Interrogation_Position=1009; Antisense; ATTTCAGCAGCTGTACACCGAGGAA
>probe:Drosophila_2:1635811_at:140:501; Interrogation_Position=1065; Antisense; GTGCGTAAACGTGCGACGGGACCAA
>probe:Drosophila_2:1635811_at:165:547; Interrogation_Position=1093; Antisense; GGATGCGTTTCTAGACCGGACAGAT
>probe:Drosophila_2:1635811_at:25:3; Interrogation_Position=1130; Antisense; ATAGTCCCTAGTTGCTTTTCCAAAT
>probe:Drosophila_2:1635811_at:166:697; Interrogation_Position=1172; Antisense; TTTCTTTGGCTTTCGAGGATACCCG
>probe:Drosophila_2:1635811_at:208:613; Interrogation_Position=1216; Antisense; TGAACAAGACTGATTGCACCCGCTT
>probe:Drosophila_2:1635811_at:407:299; Interrogation_Position=1262; Antisense; CGCGTCGCGCTAGGCTAAACTACAA
>probe:Drosophila_2:1635811_at:544:293; Interrogation_Position=762; Antisense; CGATGTAATCCAACCACCGATGATG
>probe:Drosophila_2:1635811_at:254:437; Interrogation_Position=798; Antisense; GAGGAGGATTCAACGCCGCCAACAG
>probe:Drosophila_2:1635811_at:31:285; Interrogation_Position=830; Antisense; CTGCGTGCGTCGTACTTTATTTACA
>probe:Drosophila_2:1635811_at:92:101; Interrogation_Position=875; Antisense; AGAGGATGCCGATTTCATACCCGTG
>probe:Drosophila_2:1635811_at:177:103; Interrogation_Position=955; Antisense; AGACTGGCGAGGTAGTGATCCCCGT
>probe:Drosophila_2:1635811_at:213:513; Interrogation_Position=969; Antisense; GTGATCCCCGTAGATATATCCACAG
>probe:Drosophila_2:1635811_at:692:23; Interrogation_Position=984; Antisense; ATATCCACAGCCTTGAAGACCACAA

Paste this into a BLAST search page for me
ATTTCAGCAGCTGTACACCGAGGAAGTGCGTAAACGTGCGACGGGACCAAGGATGCGTTTCTAGACCGGACAGATATAGTCCCTAGTTGCTTTTCCAAATTTTCTTTGGCTTTCGAGGATACCCGTGAACAAGACTGATTGCACCCGCTTCGCGTCGCGCTAGGCTAAACTACAACGATGTAATCCAACCACCGATGATGGAGGAGGATTCAACGCCGCCAACAGCTGCGTGCGTCGTACTTTATTTACAAGAGGATGCCGATTTCATACCCGTGAGACTGGCGAGGTAGTGATCCCCGTGTGATCCCCGTAGATATATCCACAGATATCCACAGCCTTGAAGACCACAA

Full Affymetrix probeset data:

Annotations for 1635811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720