FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635812_at:

>probe:Drosophila_2:1635812_at:99:599; Interrogation_Position=1503; Antisense; TGTCCGCGACACCATTATCAAGCAG
>probe:Drosophila_2:1635812_at:303:209; Interrogation_Position=1522; Antisense; AAGCAGGCAGACACCATTCTACTTG
>probe:Drosophila_2:1635812_at:547:141; Interrogation_Position=1542; Antisense; ACTTGGATACCCCTTGAATTTCGAT
>probe:Drosophila_2:1635812_at:579:491; Interrogation_Position=1609; Antisense; GTAACCCGTGAATCTGGTCCAGCAA
>probe:Drosophila_2:1635812_at:212:231; Interrogation_Position=1632; Antisense; AATGACGTGGTCCATGTTCGCAGCC
>probe:Drosophila_2:1635812_at:38:127; Interrogation_Position=1653; Antisense; AGCCAACTATCTACGAAACCTTCAG
>probe:Drosophila_2:1635812_at:51:393; Interrogation_Position=1667; Antisense; GAAACCTTCAGCTAACTCTGGCAAA
>probe:Drosophila_2:1635812_at:137:253; Interrogation_Position=1713; Antisense; CAAGAGCTACGTACGGCCGGAGTTT
>probe:Drosophila_2:1635812_at:611:3; Interrogation_Position=1759; Antisense; ATTGGTTACGATGGCTCGGCGAACT
>probe:Drosophila_2:1635812_at:202:3; Interrogation_Position=1795; Antisense; ATTGGTGGTTTCCTTCAAGCTCTGA
>probe:Drosophila_2:1635812_at:626:207; Interrogation_Position=1811; Antisense; AAGCTCTGATCTTCGGTTACGGTGG
>probe:Drosophila_2:1635812_at:471:639; Interrogation_Position=1880; Antisense; TCGGTATATCTTTGACGCCGCCAAA
>probe:Drosophila_2:1635812_at:146:685; Interrogation_Position=1920; Antisense; TATCAACTCTATTCCATACGGGCAG
>probe:Drosophila_2:1635812_at:309:107; Interrogation_Position=2036; Antisense; AGAAGCGAACCATCCTTGGCAGATC

Paste this into a BLAST search page for me
TGTCCGCGACACCATTATCAAGCAGAAGCAGGCAGACACCATTCTACTTGACTTGGATACCCCTTGAATTTCGATGTAACCCGTGAATCTGGTCCAGCAAAATGACGTGGTCCATGTTCGCAGCCAGCCAACTATCTACGAAACCTTCAGGAAACCTTCAGCTAACTCTGGCAAACAAGAGCTACGTACGGCCGGAGTTTATTGGTTACGATGGCTCGGCGAACTATTGGTGGTTTCCTTCAAGCTCTGAAAGCTCTGATCTTCGGTTACGGTGGTCGGTATATCTTTGACGCCGCCAAATATCAACTCTATTCCATACGGGCAGAGAAGCGAACCATCCTTGGCAGATC

Full Affymetrix probeset data:

Annotations for 1635812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720