Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635813_at:

>probe:Drosophila_2:1635813_at:552:95; Interrogation_Position=1292; Antisense; AGATATGGATCTTTGGGCACGCTGA
>probe:Drosophila_2:1635813_at:250:285; Interrogation_Position=1313; Antisense; CTGATGAGCGATGGCGTCACCGTGA
>probe:Drosophila_2:1635813_at:425:575; Interrogation_Position=1325; Antisense; GGCGTCACCGTGATGCGTACGAAGA
>probe:Drosophila_2:1635813_at:95:341; Interrogation_Position=1403; Antisense; GCTACAGAACACCTTAACTCCAGAG
>probe:Drosophila_2:1635813_at:85:225; Interrogation_Position=1431; Antisense; AAGGATCTCGATCCGTCGGCTCCAA
>probe:Drosophila_2:1635813_at:246:573; Interrogation_Position=1448; Antisense; GGCTCCAACGATCTTGTCTCTGGCA
>probe:Drosophila_2:1635813_at:177:261; Interrogation_Position=1471; Antisense; CACCCAGCTGCCCAAGAATGGTATT
>probe:Drosophila_2:1635813_at:269:369; Interrogation_Position=1486; Antisense; GAATGGTATTCGTCCCACAAGCCAA
>probe:Drosophila_2:1635813_at:300:253; Interrogation_Position=1508; Antisense; CAAGCACCCAAATCTGTCTATTCAA
>probe:Drosophila_2:1635813_at:262:163; Interrogation_Position=1557; Antisense; AAATTTCGACGCCAAATCTTTGCAA
>probe:Drosophila_2:1635813_at:551:369; Interrogation_Position=1603; Antisense; GAAGGATTTATTTTCCAAACCATCG
>probe:Drosophila_2:1635813_at:551:271; Interrogation_Position=1623; Antisense; CATCGGACTTTGTGGTTCCTCAATT
>probe:Drosophila_2:1635813_at:494:299; Interrogation_Position=1704; Antisense; CGCCGGCCAGGAACGTGATACATTT
>probe:Drosophila_2:1635813_at:441:169; Interrogation_Position=1755; Antisense; AAATGGCTTTGTTCCTACGTCAAGC

Paste this into a BLAST search page for me
AGATATGGATCTTTGGGCACGCTGACTGATGAGCGATGGCGTCACCGTGAGGCGTCACCGTGATGCGTACGAAGAGCTACAGAACACCTTAACTCCAGAGAAGGATCTCGATCCGTCGGCTCCAAGGCTCCAACGATCTTGTCTCTGGCACACCCAGCTGCCCAAGAATGGTATTGAATGGTATTCGTCCCACAAGCCAACAAGCACCCAAATCTGTCTATTCAAAAATTTCGACGCCAAATCTTTGCAAGAAGGATTTATTTTCCAAACCATCGCATCGGACTTTGTGGTTCCTCAATTCGCCGGCCAGGAACGTGATACATTTAAATGGCTTTGTTCCTACGTCAAGC

Full Affymetrix probeset data:

Annotations for 1635813_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime