FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635815_at:

>probe:Drosophila_2:1635815_at:31:373; Interrogation_Position=408; Antisense; GAAGGGTATTACTCGGGAGCTGCCT
>probe:Drosophila_2:1635815_at:111:529; Interrogation_Position=422; Antisense; GGGAGCTGCCTACAACAACGATATT
>probe:Drosophila_2:1635815_at:395:9; Interrogation_Position=444; Antisense; ATTGCCATTCTATTTGTGGATCCCC
>probe:Drosophila_2:1635815_at:21:537; Interrogation_Position=602; Antisense; GGTCGATGTCCCGATTGTGAGCAAC
>probe:Drosophila_2:1635815_at:32:253; Interrogation_Position=623; Antisense; CAACGAGCTTTGTGATCAGGACTAC
>probe:Drosophila_2:1635815_at:558:461; Interrogation_Position=651; Antisense; GATTTTGGCGACGAGACCTACCGCA
>probe:Drosophila_2:1635815_at:198:673; Interrogation_Position=669; Antisense; TACCGCATTACATCGGCCATGTTGT
>probe:Drosophila_2:1635815_at:453:727; Interrogation_Position=753; Antisense; TTGGCGGTGCGCGATGAACTCTATG
>probe:Drosophila_2:1635815_at:651:357; Interrogation_Position=793; Antisense; GCAACAGTTGTGCACTGCCCAATTA
>probe:Drosophila_2:1635815_at:669:683; Interrogation_Position=816; Antisense; TATCCCGGCGTCTATGCCAATGTGG
>probe:Drosophila_2:1635815_at:388:291; Interrogation_Position=841; Antisense; CGTACCTGAGGCCTTGGATCGATGC
>probe:Drosophila_2:1635815_at:303:319; Interrogation_Position=864; Antisense; GCCGTTTTGGCAGGGCTCTAAATTA
>probe:Drosophila_2:1635815_at:430:681; Interrogation_Position=893; Antisense; TATCACCCATTCCACGTTTTGTAAA
>probe:Drosophila_2:1635815_at:541:639; Interrogation_Position=928; Antisense; TCTGAAGCCACGTGCCTTAGGGTTT

Paste this into a BLAST search page for me
GAAGGGTATTACTCGGGAGCTGCCTGGGAGCTGCCTACAACAACGATATTATTGCCATTCTATTTGTGGATCCCCGGTCGATGTCCCGATTGTGAGCAACCAACGAGCTTTGTGATCAGGACTACGATTTTGGCGACGAGACCTACCGCATACCGCATTACATCGGCCATGTTGTTTGGCGGTGCGCGATGAACTCTATGGCAACAGTTGTGCACTGCCCAATTATATCCCGGCGTCTATGCCAATGTGGCGTACCTGAGGCCTTGGATCGATGCGCCGTTTTGGCAGGGCTCTAAATTATATCACCCATTCCACGTTTTGTAAATCTGAAGCCACGTGCCTTAGGGTTT

Full Affymetrix probeset data:

Annotations for 1635815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720