FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635817_at:

>probe:Drosophila_2:1635817_at:69:593; Interrogation_Position=376; Antisense; TGGTGACACCAAGGTTGCCGACGAC
>probe:Drosophila_2:1635817_at:251:1; Interrogation_Position=391; Antisense; TGCCGACGACGGCTACCGGTACAAA
>probe:Drosophila_2:1635817_at:671:533; Interrogation_Position=418; Antisense; GGTGCGCAAGCTTAAGTTCCGTGCT
>probe:Drosophila_2:1635817_at:11:409; Interrogation_Position=455; Antisense; GACGTCTCCGAAATCGCTGAGCCCA
>probe:Drosophila_2:1635817_at:615:77; Interrogation_Position=504; Antisense; AGGTTGAGCTTGCTCCCGAGCTAAA
>probe:Drosophila_2:1635817_at:64:323; Interrogation_Position=515; Antisense; GCTCCCGAGCTAAAAACCATTCTTG
>probe:Drosophila_2:1635817_at:81:91; Interrogation_Position=555; Antisense; AGTACAAGACAGTGCGCCGTCTCAA
>probe:Drosophila_2:1635817_at:57:71; Interrogation_Position=693; Antisense; AGGCCGAGCCAAAGTCCGCTGAGGA
>probe:Drosophila_2:1635817_at:315:335; Interrogation_Position=747; Antisense; GCTACAAGACTGTGCGCCGTCTGCG
>probe:Drosophila_2:1635817_at:709:289; Interrogation_Position=796; Antisense; CGATCCGAACCTGGGCACATTGAAC
>probe:Drosophila_2:1635817_at:357:383; Interrogation_Position=858; Antisense; GAACGGGCCTCGTCCAATCGACTGA
>probe:Drosophila_2:1635817_at:77:237; Interrogation_Position=873; Antisense; AATCGACTGACTTCTTCTTTTGGCC
>probe:Drosophila_2:1635817_at:249:691; Interrogation_Position=891; Antisense; TTTGGCCCTTCCTAATACTTATTCA
>probe:Drosophila_2:1635817_at:355:13; Interrogation_Position=911; Antisense; ATTCACTCAGTTGTCACAGCATATG

Paste this into a BLAST search page for me
TGGTGACACCAAGGTTGCCGACGACTGCCGACGACGGCTACCGGTACAAAGGTGCGCAAGCTTAAGTTCCGTGCTGACGTCTCCGAAATCGCTGAGCCCAAGGTTGAGCTTGCTCCCGAGCTAAAGCTCCCGAGCTAAAAACCATTCTTGAGTACAAGACAGTGCGCCGTCTCAAAGGCCGAGCCAAAGTCCGCTGAGGAGCTACAAGACTGTGCGCCGTCTGCGCGATCCGAACCTGGGCACATTGAACGAACGGGCCTCGTCCAATCGACTGAAATCGACTGACTTCTTCTTTTGGCCTTTGGCCCTTCCTAATACTTATTCAATTCACTCAGTTGTCACAGCATATG

Full Affymetrix probeset data:

Annotations for 1635817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720