Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635818_at:

>probe:Drosophila_2:1635818_at:641:561; Interrogation_Position=2394; Antisense; GGAACCGTAAATGTCAAGCTGCAGC
>probe:Drosophila_2:1635818_at:519:205; Interrogation_Position=2409; Antisense; AAGCTGCAGCCATTGGAGACCAAGT
>probe:Drosophila_2:1635818_at:148:623; Interrogation_Position=2433; Antisense; TGCGAGATACACGACACATATGATC
>probe:Drosophila_2:1635818_at:414:563; Interrogation_Position=2492; Antisense; GGAAGTCAAGATACGCGTTCGCAAT
>probe:Drosophila_2:1635818_at:20:363; Interrogation_Position=2512; Antisense; GCAATCCTATTCTCACCAAGCAAAT
>probe:Drosophila_2:1635818_at:137:467; Interrogation_Position=2558; Antisense; GTTGGTCTTGGATGCCTAGGGCTAA
>probe:Drosophila_2:1635818_at:161:163; Interrogation_Position=2600; Antisense; AAATAGGAACGCGTCCCCTTGCGAT
>probe:Drosophila_2:1635818_at:488:217; Interrogation_Position=2690; Antisense; AAGTATGTACGCTTTTGCCGATTCC
>probe:Drosophila_2:1635818_at:229:695; Interrogation_Position=2703; Antisense; TTTGCCGATTCCTTCGCAGGAAGAA
>probe:Drosophila_2:1635818_at:29:483; Interrogation_Position=2796; Antisense; GTATATATGATATTGCCGGCGTTAA
>probe:Drosophila_2:1635818_at:475:219; Interrogation_Position=2832; Antisense; AAGTCCAGAAGATTGTGCCGGTGAA
>probe:Drosophila_2:1635818_at:330:625; Interrogation_Position=2847; Antisense; TGCCGGTGAAGTCAGTCCATTCCAA
>probe:Drosophila_2:1635818_at:332:99; Interrogation_Position=2885; Antisense; AGAGTAGGATCGGTCCACTAGCGCC
>probe:Drosophila_2:1635818_at:351:675; Interrogation_Position=2903; Antisense; TAGCGCCTAGCCGAAACCTGATTAT

Paste this into a BLAST search page for me
GGAACCGTAAATGTCAAGCTGCAGCAAGCTGCAGCCATTGGAGACCAAGTTGCGAGATACACGACACATATGATCGGAAGTCAAGATACGCGTTCGCAATGCAATCCTATTCTCACCAAGCAAATGTTGGTCTTGGATGCCTAGGGCTAAAAATAGGAACGCGTCCCCTTGCGATAAGTATGTACGCTTTTGCCGATTCCTTTGCCGATTCCTTCGCAGGAAGAAGTATATATGATATTGCCGGCGTTAAAAGTCCAGAAGATTGTGCCGGTGAATGCCGGTGAAGTCAGTCCATTCCAAAGAGTAGGATCGGTCCACTAGCGCCTAGCGCCTAGCCGAAACCTGATTAT

Full Affymetrix probeset data:

Annotations for 1635818_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime