Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635819_at:

>probe:Drosophila_2:1635819_at:88:29; Interrogation_Position=3843; Antisense; ATACGCCTAGATATACACACTGAAA
>probe:Drosophila_2:1635819_at:454:457; Interrogation_Position=3852; Antisense; GATATACACACTGAAAACTATGCTT
>probe:Drosophila_2:1635819_at:589:679; Interrogation_Position=3870; Antisense; TATGCTTAAAACTCCTAACTTCTAA
>probe:Drosophila_2:1635819_at:161:329; Interrogation_Position=3949; Antisense; GCTGGAAAAACTCCTTAAAGCCTAG
>probe:Drosophila_2:1635819_at:349:143; Interrogation_Position=3958; Antisense; ACTCCTTAAAGCCTAGCCGTTAATG
>probe:Drosophila_2:1635819_at:207:203; Interrogation_Position=3966; Antisense; AAGCCTAGCCGTTAATGAAAATTCA
>probe:Drosophila_2:1635819_at:676:183; Interrogation_Position=3983; Antisense; AAAATTCAAGAAGCGCAGACCTACA
>probe:Drosophila_2:1635819_at:278:211; Interrogation_Position=3990; Antisense; AAGAAGCGCAGACCTACAACAAAAA
>probe:Drosophila_2:1635819_at:450:567; Interrogation_Position=4076; Antisense; GGCACTCTATACATACAAAAGCTAT
>probe:Drosophila_2:1635819_at:385:125; Interrogation_Position=4149; Antisense; ACTGAGTAGAAAGTGGACGCGTTGA
>probe:Drosophila_2:1635819_at:561:539; Interrogation_Position=4191; Antisense; GGTTTTCACTACGATGCCCTGGAGA
>probe:Drosophila_2:1635819_at:484:257; Interrogation_Position=4197; Antisense; CACTACGATGCCCTGGAGAACCAGA
>probe:Drosophila_2:1635819_at:348:549; Interrogation_Position=4211; Antisense; GGAGAACCAGAAGAACTTTATGTAA
>probe:Drosophila_2:1635819_at:591:107; Interrogation_Position=4243; Antisense; AGAATGTATGTTCCGTTGAAAACTA

Paste this into a BLAST search page for me
ATACGCCTAGATATACACACTGAAAGATATACACACTGAAAACTATGCTTTATGCTTAAAACTCCTAACTTCTAAGCTGGAAAAACTCCTTAAAGCCTAGACTCCTTAAAGCCTAGCCGTTAATGAAGCCTAGCCGTTAATGAAAATTCAAAAATTCAAGAAGCGCAGACCTACAAAGAAGCGCAGACCTACAACAAAAAGGCACTCTATACATACAAAAGCTATACTGAGTAGAAAGTGGACGCGTTGAGGTTTTCACTACGATGCCCTGGAGACACTACGATGCCCTGGAGAACCAGAGGAGAACCAGAAGAACTTTATGTAAAGAATGTATGTTCCGTTGAAAACTA

Full Affymetrix probeset data:

Annotations for 1635819_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime