FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635821_at:

>probe:Drosophila_2:1635821_at:309:611; Interrogation_Position=182; Antisense; TGACGCTGACCAAACAGGAGCCGAA
>probe:Drosophila_2:1635821_at:623:157; Interrogation_Position=253; Antisense; ACAAATCGCTTCATAGACGTCGCCC
>probe:Drosophila_2:1635821_at:300:169; Interrogation_Position=281; Antisense; AAATGGAGGCGTTCTTCCTGCAGAA
>probe:Drosophila_2:1635821_at:188:617; Interrogation_Position=299; Antisense; TGCAGAAGCGTTTTCTCGTCTCCAC
>probe:Drosophila_2:1635821_at:508:331; Interrogation_Position=324; Antisense; GCTGAAGCCCTACATGCTGATCAAG
>probe:Drosophila_2:1635821_at:235:35; Interrogation_Position=356; Antisense; ATCAGGACCTGAGCATCGAGATTCA
>probe:Drosophila_2:1635821_at:208:77; Interrogation_Position=386; Antisense; AGGAGGCACTCCTGCAGAAGCACTA
>probe:Drosophila_2:1635821_at:261:83; Interrogation_Position=425; Antisense; AGTGGAAGGCCTGCCTATCGGACAT
>probe:Drosophila_2:1635821_at:467:683; Interrogation_Position=440; Antisense; TATCGGACATCCAACAGGGCGTACA
>probe:Drosophila_2:1635821_at:598:41; Interrogation_Position=484; Antisense; ATCGGCTCTGGAATGCTGCAAGGTC
>probe:Drosophila_2:1635821_at:115:367; Interrogation_Position=518; Antisense; GAATGCCACCCATGGGAGGTACACC
>probe:Drosophila_2:1635821_at:317:369; Interrogation_Position=566; Antisense; GAATGCCTCCGGGTGCAATGCAACC
>probe:Drosophila_2:1635821_at:274:113; Interrogation_Position=641; Antisense; AGCAGCTCCGCATGATAAGCAGACA
>probe:Drosophila_2:1635821_at:36:565; Interrogation_Position=686; Antisense; GGAATGCATTCCTTTTAGCTTGTAA

Paste this into a BLAST search page for me
TGACGCTGACCAAACAGGAGCCGAAACAAATCGCTTCATAGACGTCGCCCAAATGGAGGCGTTCTTCCTGCAGAATGCAGAAGCGTTTTCTCGTCTCCACGCTGAAGCCCTACATGCTGATCAAGATCAGGACCTGAGCATCGAGATTCAAGGAGGCACTCCTGCAGAAGCACTAAGTGGAAGGCCTGCCTATCGGACATTATCGGACATCCAACAGGGCGTACAATCGGCTCTGGAATGCTGCAAGGTCGAATGCCACCCATGGGAGGTACACCGAATGCCTCCGGGTGCAATGCAACCAGCAGCTCCGCATGATAAGCAGACAGGAATGCATTCCTTTTAGCTTGTAA

Full Affymetrix probeset data:

Annotations for 1635821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720