FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635822_at:

>probe:Drosophila_2:1635822_at:633:591; Interrogation_Position=3500; Antisense; TGGTGGCGCTGGTCTGCTAAATCCG
>probe:Drosophila_2:1635822_at:263:165; Interrogation_Position=3518; Antisense; AAATCCGGGCGCCACAGTTGTGTCG
>probe:Drosophila_2:1635822_at:333:605; Interrogation_Position=3571; Antisense; TGATGCTCAAGAAGCGACGCTCGAA
>probe:Drosophila_2:1635822_at:11:215; Interrogation_Position=3594; Antisense; AAGAGCAGGAAAGCACCGGCGCCTC
>probe:Drosophila_2:1635822_at:435:469; Interrogation_Position=3672; Antisense; GTTGCCGGATCTGGTATGACGTCAT
>probe:Drosophila_2:1635822_at:490:537; Interrogation_Position=3684; Antisense; GGTATGACGTCATCGGCGCCAGCGT
>probe:Drosophila_2:1635822_at:181:359; Interrogation_Position=3725; Antisense; GCAACATCAATCGACGGCAGATCAA
>probe:Drosophila_2:1635822_at:688:587; Interrogation_Position=3764; Antisense; TGGAGCGGAACTGCTGCATCTTCGG
>probe:Drosophila_2:1635822_at:224:347; Interrogation_Position=3779; Antisense; GCATCTTCGGCTGCTCGAGGAGGAC
>probe:Drosophila_2:1635822_at:5:45; Interrogation_Position=3824; Antisense; ATCGACATCGTCTGGCGGCGCTGGA
>probe:Drosophila_2:1635822_at:611:153; Interrogation_Position=3957; Antisense; ACAGGCAGCGGTACAGCAACGCGCG
>probe:Drosophila_2:1635822_at:593:323; Interrogation_Position=3977; Antisense; GCGCGGCAAGCTGGACTTCCTGTAG
>probe:Drosophila_2:1635822_at:498:631; Interrogation_Position=3994; Antisense; TCCTGTAGCCCACGACGATCGGGAA
>probe:Drosophila_2:1635822_at:348:411; Interrogation_Position=4038; Antisense; GACGCCTCCAGCCAGGAGCAATAAT

Paste this into a BLAST search page for me
TGGTGGCGCTGGTCTGCTAAATCCGAAATCCGGGCGCCACAGTTGTGTCGTGATGCTCAAGAAGCGACGCTCGAAAAGAGCAGGAAAGCACCGGCGCCTCGTTGCCGGATCTGGTATGACGTCATGGTATGACGTCATCGGCGCCAGCGTGCAACATCAATCGACGGCAGATCAATGGAGCGGAACTGCTGCATCTTCGGGCATCTTCGGCTGCTCGAGGAGGACATCGACATCGTCTGGCGGCGCTGGAACAGGCAGCGGTACAGCAACGCGCGGCGCGGCAAGCTGGACTTCCTGTAGTCCTGTAGCCCACGACGATCGGGAAGACGCCTCCAGCCAGGAGCAATAAT

Full Affymetrix probeset data:

Annotations for 1635822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720